Incidental Mutation 'R6220:Ddx54'
ID503943
Institutional Source Beutler Lab
Gene Symbol Ddx54
Ensembl Gene ENSMUSG00000029599
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Synonyms2410015A15Rik, APR-5, DP97
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120612739-120628592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120620689 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 332 (N332K)
Ref Sequence ENSEMBL: ENSMUSP00000031598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598]
Predicted Effect probably benign
Transcript: ENSMUST00000031598
AA Change: N332K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599
AA Change: N332K

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Ddx54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ddx54 APN 5 120623810 critical splice donor site probably null
IGL01324:Ddx54 APN 5 120623638 missense probably benign 0.00
IGL01399:Ddx54 APN 5 120623903 nonsense probably null
IGL02052:Ddx54 APN 5 120625718 missense possibly damaging 0.93
IGL02095:Ddx54 APN 5 120623791 missense possibly damaging 0.81
IGL02370:Ddx54 APN 5 120619787 missense probably damaging 1.00
IGL02861:Ddx54 APN 5 120618130 splice site probably benign
R0521:Ddx54 UTSW 5 120626862 missense probably benign 0.00
R0556:Ddx54 UTSW 5 120619654 splice site probably benign
R0723:Ddx54 UTSW 5 120623638 missense probably benign 0.00
R2968:Ddx54 UTSW 5 120618629 missense probably damaging 1.00
R4622:Ddx54 UTSW 5 120626423 missense probably damaging 1.00
R4853:Ddx54 UTSW 5 120623629 missense probably benign 0.12
R5168:Ddx54 UTSW 5 120617032 missense probably benign 0.00
R5169:Ddx54 UTSW 5 120623263 missense probably damaging 1.00
R5424:Ddx54 UTSW 5 120619861 critical splice donor site probably null
R5489:Ddx54 UTSW 5 120624721 missense probably benign
R5956:Ddx54 UTSW 5 120626367 unclassified probably benign
R5999:Ddx54 UTSW 5 120623580 missense probably benign 0.00
R6413:Ddx54 UTSW 5 120627062 missense probably benign
R6477:Ddx54 UTSW 5 120621778 missense probably damaging 1.00
R6702:Ddx54 UTSW 5 120626503 missense possibly damaging 0.52
R6783:Ddx54 UTSW 5 120618714 nonsense probably null
R6865:Ddx54 UTSW 5 120621827 critical splice donor site probably null
R7258:Ddx54 UTSW 5 120620747 missense probably damaging 1.00
R7260:Ddx54 UTSW 5 120626920 missense probably benign 0.21
R7488:Ddx54 UTSW 5 120624724 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTAGACTCCAAGCTCAATGAG -3'
(R):5'- TGTCAGCGTGTGGGAAAAGC -3'

Sequencing Primer
(F):5'- CTCAATGAGCAGCTCAAGGTG -3'
(R):5'- CTCATGGGCGCGCTATTG -3'
Posted On2018-02-27