Incidental Mutation 'R6220:Smarcad1'
ID503946
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene NameSWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
SynonymsD6Pas1, Etl1
MMRRC Submission 044352-MU
Accession Numbers

Genbank: NM_007958; MGI: 95453

Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location65042583-65116061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65114329 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1011 (I1011M)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031982] [ENSMUST00000031984] [ENSMUST00000204620]
Predicted Effect probably benign
Transcript: ENSMUST00000031982
SMART Domains Protein: ENSMUSP00000031982
Gene: ENSMUSG00000029919

DomainStartEndE-ValueType
Pfam:GST_N 4 73 2.8e-13 PFAM
Pfam:GST_N_3 14 79 2.9e-7 PFAM
Pfam:GST_C 91 185 3.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031984
AA Change: I1011M

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: I1011M

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203104
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205250
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65073239 missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65052806 unclassified probably benign
IGL03006:Smarcad1 APN 6 65083889 missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65074953 missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65092526 missense probably damaging 0.98
Trollip UTSW 6 65114336 missense probably damaging 1.00
wastrel UTSW 6 65052670 missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65084007 splice site probably benign
R0452:Smarcad1 UTSW 6 65074822 missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65108727 missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65096694 missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65052647 missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65067107 missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65056416 missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65073216 missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65075011 missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65114336 missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65056459 missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65067089 missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65052641 missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65075115 missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65075041 missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65098824 missense probably null 1.00
R4928:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65074762 missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6302:Smarcad1 UTSW 6 65075138 missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65052670 missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65052732 missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65110376 missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65052711 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAGCTGTATAGGTTAGGTCAGG -3'
(R):5'- GATGTGAGGATCTGGAGAATCC -3'

Sequencing Primer
(F):5'- GGTCAGGTTTTTAATGAGATGACACC -3'
(R):5'- CCAGTTAGTGGCAAAAAGTTGTCC -3'
Posted On2018-02-27