Incidental Mutation 'R6220:Lrrc45'
ID503966
Institutional Source Beutler Lab
Gene Symbol Lrrc45
Ensembl Gene ENSMUSG00000025145
Gene Nameleucine rich repeat containing 45
Synonyms
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120713925-120721128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120719527 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 488 (I488T)
Ref Sequence ENSEMBL: ENSMUSP00000026139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026139] [ENSMUST00000142229] [ENSMUST00000145781] [ENSMUST00000151852]
Predicted Effect probably benign
Transcript: ENSMUST00000018156
SMART Domains Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 179 8.8e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026139
AA Change: I488T

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145
AA Change: I488T

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134322
Predicted Effect probably benign
Transcript: ENSMUST00000142229
SMART Domains Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 172 3.19e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145781
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150225
Predicted Effect probably benign
Transcript: ENSMUST00000151852
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155187
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Lrrc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Lrrc45 APN 11 120720610 splice site probably benign
IGL01120:Lrrc45 APN 11 120720010 missense probably benign
IGL01536:Lrrc45 APN 11 120715584 missense probably benign 0.01
IGL01839:Lrrc45 APN 11 120717149 unclassified probably null
IGL02190:Lrrc45 APN 11 120718508 missense probably damaging 0.99
IGL02302:Lrrc45 APN 11 120718525 missense possibly damaging 0.68
IGL02724:Lrrc45 APN 11 120718318 missense probably benign 0.25
R0396:Lrrc45 UTSW 11 120714907 splice site probably benign
R0420:Lrrc45 UTSW 11 120715219 missense probably damaging 1.00
R0540:Lrrc45 UTSW 11 120715162 nonsense probably null
R0833:Lrrc45 UTSW 11 120718193 unclassified probably null
R0942:Lrrc45 UTSW 11 120718238 unclassified probably benign
R1252:Lrrc45 UTSW 11 120715471 missense probably benign 0.13
R1426:Lrrc45 UTSW 11 120720013 missense probably benign 0.00
R1543:Lrrc45 UTSW 11 120720018 missense probably benign 0.06
R1570:Lrrc45 UTSW 11 120720109 critical splice donor site probably null
R2392:Lrrc45 UTSW 11 120719539 missense probably benign 0.00
R3000:Lrrc45 UTSW 11 120718447 missense probably benign 0.00
R3930:Lrrc45 UTSW 11 120718677 missense probably benign 0.06
R4158:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4161:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4432:Lrrc45 UTSW 11 120715221 critical splice donor site probably null
R4647:Lrrc45 UTSW 11 120719121 missense probably benign 0.02
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
X0026:Lrrc45 UTSW 11 120720232 missense probably damaging 1.00
Z1088:Lrrc45 UTSW 11 120720231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAGAAGTTTCCCCAGC -3'
(R):5'- CGACTCTATGTCAGCTCTACTAAC -3'

Sequencing Primer
(F):5'- AGAAGTTTCCCCAGCCTGGC -3'
(R):5'- GTCAGCTCTACTAACTCATTTCTAGC -3'
Posted On2018-02-27