Incidental Mutation 'R6220:Rps18'
ID503978
Institutional Source Beutler Lab
Gene Symbol Rps18
Ensembl Gene ENSMUSG00000008668
Gene Nameribosomal protein S18
SynonymsH-2Ke3, H2-Ke3
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33951999-33956001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33955136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 15 (V15E)
Ref Sequence ENSEMBL: ENSMUSP00000008812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025178] [ENSMUST00000087543] [ENSMUST00000173196] [ENSMUST00000174609]
Predicted Effect probably damaging
Transcript: ENSMUST00000008812
AA Change: V15E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668
AA Change: V15E

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025178
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087543
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect probably benign
Transcript: ENSMUST00000173196
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Predicted Effect possibly damaging
Transcript: ENSMUST00000174609
AA Change: V15E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668
AA Change: V15E

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Meta Mutation Damage Score 0.562 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S13P family of ribosomal proteins. It is located in the cytoplasm. The gene product of the E. coli ortholog (ribosomal protein S13) is involved in the binding of fMet-tRNA, and thus, in the initiation of translation. This gene is an ortholog of mouse Ke3. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Rps18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Rps18 APN 17 33952041 utr 3 prime probably benign
R1658:Rps18 UTSW 17 33952418 missense probably benign 0.03
R3622:Rps18 UTSW 17 33952273 unclassified probably null
R5008:Rps18 UTSW 17 33952284 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGCTGAAGATCTCGGGAAAC -3'
(R):5'- TCAGAGGTTGCGATTTCCC -3'

Sequencing Primer
(F):5'- CTCTGCAAGGTGGGACATGACTAC -3'
(R):5'- ATTTCCCGCGCCTGAGC -3'
Posted On2018-02-27