Incidental Mutation 'R6220:Rps18'
ID 503978
Institutional Source Beutler Lab
Gene Symbol Rps18
Ensembl Gene ENSMUSG00000008668
Gene Name ribosomal protein S18
Synonyms H-2Ke3, H2-Ke3
MMRRC Submission 044352-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6220 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34170972-34174639 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34174110 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 15 (V15E)
Ref Sequence ENSEMBL: ENSMUSP00000008812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025178] [ENSMUST00000087543] [ENSMUST00000173196] [ENSMUST00000174609]
AlphaFold P62270
Predicted Effect probably damaging
Transcript: ENSMUST00000008812
AA Change: V15E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668
AA Change: V15E

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025178
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087543
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect probably benign
Transcript: ENSMUST00000173196
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174609
AA Change: V15E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668
AA Change: V15E

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Meta Mutation Damage Score 0.8985 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S13P family of ribosomal proteins. It is located in the cytoplasm. The gene product of the E. coli ortholog (ribosomal protein S13) is involved in the binding of fMet-tRNA, and thus, in the initiation of translation. This gene is an ortholog of mouse Ke3. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b A G 2: 181,135,578 (GRCm39) D160G probably damaging Het
Acap1 A G 11: 69,780,505 (GRCm39) F15S probably damaging Het
Adam30 A T 3: 98,068,625 (GRCm39) S153C probably damaging Het
Afp A T 5: 90,652,269 (GRCm39) D420V possibly damaging Het
Ak9 T A 10: 41,246,095 (GRCm39) H729Q unknown Het
Armh3 T C 19: 45,834,554 (GRCm39) E618G possibly damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bcr A G 10: 74,898,124 (GRCm39) T423A probably benign Het
Cc2d1b C T 4: 108,490,422 (GRCm39) R825W probably damaging Het
Ctns T C 11: 73,083,954 (GRCm39) T23A probably benign Het
Ddx54 T A 5: 120,758,754 (GRCm39) N332K probably benign Het
Dysf T A 6: 84,126,727 (GRCm39) I1344N probably damaging Het
Elovl3 A T 19: 46,122,939 (GRCm39) M172L probably benign Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Filip1l T A 16: 57,390,352 (GRCm39) N313K probably benign Het
Foxp2 C A 6: 15,437,947 (GRCm39) T716K probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm10645 A G 8: 83,892,386 (GRCm39) probably benign Het
Gm10735 T C 13: 113,178,030 (GRCm39) probably benign Het
Gm4847 A T 1: 166,462,541 (GRCm39) D316E probably damaging Het
Gorasp2 T C 2: 70,521,134 (GRCm39) L388P probably damaging Het
Heatr5b A G 17: 79,081,106 (GRCm39) L1382P probably damaging Het
Herc1 A G 9: 66,341,070 (GRCm39) Y1729C probably damaging Het
Ifi207 A T 1: 173,557,112 (GRCm39) L542H probably damaging Het
Ighv3-5 T A 12: 114,226,338 (GRCm39) N96I probably damaging Het
Isl1 T C 13: 116,439,803 (GRCm39) T182A probably benign Het
Jph4 T C 14: 55,347,542 (GRCm39) E421G probably benign Het
Lrrc45 T C 11: 120,610,353 (GRCm39) I488T probably benign Het
Mroh8 A G 2: 157,075,083 (GRCm39) I471T probably benign Het
Ms4a2 A T 19: 11,594,927 (GRCm39) D96E probably damaging Het
Mst1r T A 9: 107,784,547 (GRCm39) N68K probably benign Het
Myo18b A G 5: 112,905,373 (GRCm39) M2075T possibly damaging Het
Neb T C 2: 52,160,984 (GRCm39) K2229R probably null Het
Nkx6-3 T A 8: 23,643,987 (GRCm39) probably null Het
Nlrp1a C A 11: 71,033,164 (GRCm39) S10I probably benign Het
Npas2 A T 1: 39,375,142 (GRCm39) T487S probably benign Het
Nrxn1 G C 17: 91,395,904 (GRCm39) T84R probably benign Het
Or4k2 C A 14: 50,424,135 (GRCm39) D180Y probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pcdh18 A G 3: 49,699,700 (GRCm39) C921R probably damaging Het
Pcdha9 A G 18: 37,131,531 (GRCm39) Y200C probably damaging Het
Pknox1 A T 17: 31,822,177 (GRCm39) R315* probably null Het
Rasgrp1 C T 2: 117,115,410 (GRCm39) W726* probably null Het
Rassf8 G A 6: 145,762,859 (GRCm39) R402H probably damaging Het
Rev3l T A 10: 39,698,775 (GRCm39) Y1091N probably damaging Het
Riok3 T G 18: 12,282,608 (GRCm39) V349G probably damaging Het
Rptor A T 11: 119,788,268 (GRCm39) Y1323F possibly damaging Het
Rspry1 T C 8: 95,385,378 (GRCm39) C437R probably damaging Het
Sema5a T A 15: 32,686,875 (GRCm39) Y996N probably damaging Het
Smarcad1 A G 6: 65,091,313 (GRCm39) I1011M probably benign Het
Supv3l1 A T 10: 62,274,800 (GRCm39) M295K possibly damaging Het
Sv2c T C 13: 96,113,134 (GRCm39) D605G probably damaging Het
Teddm1b G A 1: 153,750,947 (GRCm39) W252* probably null Het
Tes T A 6: 17,086,195 (GRCm39) C29* probably null Het
Thsd4 A G 9: 59,890,030 (GRCm39) W856R probably damaging Het
Treml4 A T 17: 48,571,876 (GRCm39) D93V possibly damaging Het
Trim66 T C 7: 109,082,300 (GRCm39) T218A probably damaging Het
Tssk5 T C 15: 76,257,973 (GRCm39) D128G probably damaging Het
Ubr3 T A 2: 69,850,819 (GRCm39) W1746R probably damaging Het
Vmn2r11 T C 5: 109,201,434 (GRCm39) I357V probably benign Het
Vmn2r87 A T 10: 130,315,807 (GRCm39) D86E probably benign Het
Zfp184 T G 13: 22,144,377 (GRCm39) H694Q probably damaging Het
Zranb3 A C 1: 127,927,141 (GRCm39) F341L probably benign Het
Other mutations in Rps18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Rps18 APN 17 34,171,015 (GRCm39) utr 3 prime probably benign
R1658:Rps18 UTSW 17 34,171,392 (GRCm39) missense probably benign 0.03
R3622:Rps18 UTSW 17 34,171,247 (GRCm39) splice site probably null
R5008:Rps18 UTSW 17 34,171,258 (GRCm39) splice site probably null
R8110:Rps18 UTSW 17 34,174,110 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGCTGAAGATCTCGGGAAAC -3'
(R):5'- TCAGAGGTTGCGATTTCCC -3'

Sequencing Primer
(F):5'- CTCTGCAAGGTGGGACATGACTAC -3'
(R):5'- ATTTCCCGCGCCTGAGC -3'
Posted On 2018-02-27