Incidental Mutation 'R6221:Thbs1'
ID503996
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R6221 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118119997 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 704 (L704M)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably damaging
Transcript: ENSMUST00000039559
AA Change: L704M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: L704M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190311
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,175,450 M108V probably benign Het
Adgrl1 C T 8: 83,937,687 Q1236* probably null Het
Adprhl1 T C 8: 13,225,634 I375V probably benign Het
Akap2 C T 4: 57,855,618 Q559* probably null Het
B020031M17Rik T G 13: 119,949,998 H24P probably damaging Het
Bsn A G 9: 108,105,566 S3663P unknown Het
Ccdc114 T C 7: 45,947,479 L410P probably damaging Het
Cfap44 A T 16: 44,437,186 Q1028L probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Col1a2 T C 6: 4,539,490 S1253P unknown Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Dmxl1 A G 18: 49,871,732 Y949C probably damaging Het
E130311K13Rik T C 3: 63,915,731 Y164C probably benign Het
Evx1 T A 6: 52,316,783 V312E probably damaging Het
Fam240b T C 13: 64,481,777 N75S probably benign Het
Fat2 A G 11: 55,296,072 probably null Het
Fbn1 G T 2: 125,320,921 D2148E probably benign Het
Fzd4 A G 7: 89,404,892 H69R probably damaging Het
Fzd6 T C 15: 39,030,844 V135A probably benign Het
Gimap8 T C 6: 48,658,942 L547S probably damaging Het
Gm12394 A T 4: 42,793,153 N326K probably benign Het
Gnrhr G A 5: 86,185,403 Q203* probably null Het
Gpaa1 T G 15: 76,333,832 V341G probably benign Het
Grik3 T A 4: 125,705,123 L828Q probably damaging Het
Heatr5b T C 17: 78,766,954 N1568S probably benign Het
Hpf1 T A 8: 60,893,774 V41E probably damaging Het
Hsd3b1 A T 3: 98,853,156 M173K probably benign Het
Hsd3b6 A G 3: 98,806,533 I150T probably benign Het
Ica1 C G 6: 8,644,181 L369F possibly damaging Het
Inf2 T G 12: 112,603,745 S293A possibly damaging Het
Klra10 T C 6: 130,269,272 T247A probably benign Het
Kpna1 G A 16: 36,020,688 G91D probably benign Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Ltb4r2 C T 14: 55,762,083 R54W probably damaging Het
Mki67 A G 7: 135,697,914 F1797S probably benign Het
Mlh3 C A 12: 85,268,418 Q331H possibly damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1489 T A 19: 13,633,466 Y118* probably null Het
Oxct2b T C 4: 123,116,808 Y174H probably damaging Het
Pclo G A 5: 14,675,313 R1395Q unknown Het
Ppara A G 15: 85,777,680 I41V probably benign Het
Ppip5k2 A T 1: 97,730,028 I766K probably damaging Het
Ppm1j A G 3: 104,785,776 N483S possibly damaging Het
Prex2 T C 1: 11,266,012 I1478T probably benign Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rsl1d1 A G 16: 11,201,311 V121A probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Slc15a1 T C 14: 121,464,904 Q610R probably null Het
Slc1a6 A G 10: 78,800,076 E325G probably damaging Het
Slc7a13 A G 4: 19,839,305 I303V probably benign Het
Smc3 T A 19: 53,641,931 V1123E probably damaging Het
Smco1 G A 16: 32,273,205 V34I probably benign Het
Spag1 A G 15: 36,197,803 R304G probably benign Het
Spta1 A G 1: 174,181,776 D293G probably damaging Het
Sspo C A 6: 48,463,705 P1751Q probably damaging Het
Syt14 A T 1: 192,930,600 Y631N probably damaging Het
Taar3 A G 10: 23,950,072 N172S possibly damaging Het
Tank A G 2: 61,650,083 E321G probably damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Togaram1 A T 12: 64,966,546 E190D probably damaging Het
Traf1 A C 2: 34,948,301 V175G probably benign Het
Trib3 A T 2: 152,338,608 C222S probably damaging Het
Tsen34 T A 7: 3,695,544 I229N probably damaging Het
Ttc28 A G 5: 111,271,248 D1370G probably benign Het
Ugt1a5 G A 1: 88,166,242 R64H probably benign Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vdac3 A G 8: 22,588,743 V17A possibly damaging Het
Yif1b C T 7: 29,245,782 T220I possibly damaging Het
Zfp846 T G 9: 20,593,295 H150Q possibly damaging Het
Zwilch A T 9: 64,161,383 H181Q probably damaging Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGGATACTGTACCCTCAG -3'
(R):5'- GGCGACACAGTTAGCATTCG -3'

Sequencing Primer
(F):5'- TCAGGTGTGCAAACCGC -3'
(R):5'- GCTTGTTTGGCGCACAC -3'
Posted On2018-02-28