Incidental Mutation 'R6224:Asgr2'
ID504204
Institutional Source Beutler Lab
Gene Symbol Asgr2
Ensembl Gene ENSMUSG00000040963
Gene Nameasialoglycoprotein receptor 2
SynonymsASGPR2, Asgr-2, Asgr
MMRRC Submission 044355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6224 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70092644-70106187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70098246 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000121189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102572] [ENSMUST00000124721] [ENSMUST00000143772]
Predicted Effect probably benign
Transcript: ENSMUST00000102572
AA Change: V172A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099632
Gene: ENSMUSG00000040963
AA Change: V172A

DomainStartEndE-ValueType
Pfam:Lectin_N 29 162 1.5e-58 PFAM
CLECT 170 294 3.51e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124721
AA Change: V172A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121189
Gene: ENSMUSG00000040963
AA Change: V172A

DomainStartEndE-ValueType
Pfam:Lectin_N 25 162 1e-69 PFAM
CLECT 170 226 1.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143772
AA Change: V69A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136505
Gene: ENSMUSG00000040963
AA Change: V69A

DomainStartEndE-ValueType
Pfam:Lectin_N 1 59 7.5e-27 PFAM
CLECT 67 191 3.51e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179757
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in reduced ASGR1 protein expression and deficiency in clearance of asialoorsomucoid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A C 11: 99,838,014 M1R probably null Het
4930505A04Rik A C 11: 30,454,815 N29K probably benign Het
Adamtsl4 T C 3: 95,681,729 Y464C probably damaging Het
Atad1 T C 19: 32,698,628 Y132C probably damaging Het
Bpifa6 G A 2: 153,987,153 R200H probably damaging Het
Brd1 A T 15: 88,688,355 M1171K possibly damaging Het
Cadm2 A T 16: 66,664,395 L392Q probably damaging Het
Ccdc183 C T 2: 25,610,582 E333K possibly damaging Het
Cenpe T C 3: 135,243,775 I1335T possibly damaging Het
Cpxm2 T C 7: 132,143,731 N122D probably benign Het
Crls1 T A 2: 132,849,850 probably null Het
Cyp46a1 T C 12: 108,361,560 F460S probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcps T A 9: 35,136,481 T128S probably benign Het
Dcun1d3 A T 7: 119,859,491 L107* probably null Het
Eml1 T C 12: 108,514,508 F397S probably damaging Het
Fanca T A 8: 123,305,281 H348L possibly damaging Het
Foxo1 T A 3: 52,345,672 S419T probably benign Het
Gli3 T C 13: 15,725,145 V1039A probably benign Het
Gm5741 A T 8: 85,067,591 *73R probably null Het
Gp6 A T 7: 4,394,212 F75I probably benign Het
Gpha2 T A 19: 6,227,112 I81N possibly damaging Het
Gspt1 C A 16: 11,224,542 V493L probably benign Het
Igsf10 C A 3: 59,325,510 C1934F probably damaging Het
Irgm1 T C 11: 48,866,886 T49A probably benign Het
Klc4 A G 17: 46,640,062 I207T possibly damaging Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Lama1 T C 17: 67,802,987 V2201A possibly damaging Het
Lilrb4a T A 10: 51,491,649 Y96N probably damaging Het
Lrfn2 A G 17: 49,096,351 T501A probably damaging Het
Lrriq1 A G 10: 103,215,757 I378T probably damaging Het
Mphosph8 T C 14: 56,668,353 M1T probably null Het
Nsd1 T C 13: 55,313,132 S2391P possibly damaging Het
Ogdhl G A 14: 32,342,061 G647D probably benign Het
Olfr480 T C 7: 108,066,742 I19V probably benign Het
Olfr813 A G 10: 129,857,192 K225E probably benign Het
Pbrm1 T A 14: 31,050,111 H387Q probably benign Het
Pdgfrb C A 18: 61,081,939 Y1013* probably null Het
Pitrm1 T C 13: 6,565,054 V562A probably damaging Het
Pnpla8 T C 12: 44,283,028 V121A possibly damaging Het
Psd4 T C 2: 24,401,557 L639P probably damaging Het
Psmc3 G T 2: 91,054,630 R47L probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sesn2 A G 4: 132,502,570 V50A probably benign Het
Slc6a16 G A 7: 45,261,148 G377S probably damaging Het
Slitrk1 A G 14: 108,912,022 F419S probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Spata31d1a T A 13: 59,706,320 probably benign Homo
Tgoln1 A T 6: 72,616,001 D165E possibly damaging Het
Tmprss15 T A 16: 79,024,378 T492S probably benign Het
Ttc37 C T 13: 76,118,291 T219M probably benign Het
Zc3h13 T A 14: 75,337,409 M1565K probably damaging Het
Zcwpw1 T C 5: 137,812,036 V358A possibly damaging Het
Zfp607a A G 7: 27,878,582 H359R probably damaging Het
Zzef1 T A 11: 72,855,383 V837E probably damaging Het
Other mutations in Asgr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Asgr2 APN 11 70105367 splice site probably benign
IGL01936:Asgr2 APN 11 70098051 critical splice acceptor site probably null
IGL02827:Asgr2 APN 11 70096897 missense probably benign 0.05
IGL03034:Asgr2 APN 11 70098263 missense probably damaging 0.99
R0569:Asgr2 UTSW 11 70097877 missense probably benign 0.04
R1240:Asgr2 UTSW 11 70096850 missense possibly damaging 0.81
R1748:Asgr2 UTSW 11 70096832 missense probably damaging 0.99
R1920:Asgr2 UTSW 11 70098297 missense possibly damaging 0.93
R3016:Asgr2 UTSW 11 70105409 missense probably damaging 0.97
R4293:Asgr2 UTSW 11 70098231 missense probably benign 0.43
R4423:Asgr2 UTSW 11 70105385 missense probably benign 0.44
R4988:Asgr2 UTSW 11 70097839 missense probably benign 0.05
R6981:Asgr2 UTSW 11 70096810 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGGAGTCACAAGCCTACCG -3'
(R):5'- CTTGATCAGGCTACTTGATCAAGC -3'

Sequencing Primer
(F):5'- ACATTGCTCTTTCACCTGAAGCAC -3'
(R):5'- ACTTGATCAAGCCTACCTTCAGG -3'
Posted On2018-02-28