Incidental Mutation 'R6224:Gli3'
ID504211
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission 044355-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6224 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15725145 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1039 (V1039A)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
Predicted Effect probably benign
Transcript: ENSMUST00000110510
AA Change: V1039A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: V1039A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A C 11: 99,838,014 M1R probably null Het
4930505A04Rik A C 11: 30,454,815 N29K probably benign Het
Adamtsl4 T C 3: 95,681,729 Y464C probably damaging Het
Asgr2 T C 11: 70,098,246 V172A probably damaging Het
Atad1 T C 19: 32,698,628 Y132C probably damaging Het
Bpifa6 G A 2: 153,987,153 R200H probably damaging Het
Brd1 A T 15: 88,688,355 M1171K possibly damaging Het
Cadm2 A T 16: 66,664,395 L392Q probably damaging Het
Ccdc183 C T 2: 25,610,582 E333K possibly damaging Het
Cenpe T C 3: 135,243,775 I1335T possibly damaging Het
Cpxm2 T C 7: 132,143,731 N122D probably benign Het
Crls1 T A 2: 132,849,850 probably null Het
Cyp46a1 T C 12: 108,361,560 F460S probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcps T A 9: 35,136,481 T128S probably benign Het
Dcun1d3 A T 7: 119,859,491 L107* probably null Het
Eml1 T C 12: 108,514,508 F397S probably damaging Het
Fanca T A 8: 123,305,281 H348L possibly damaging Het
Foxo1 T A 3: 52,345,672 S419T probably benign Het
Gm5741 A T 8: 85,067,591 *73R probably null Het
Gp6 A T 7: 4,394,212 F75I probably benign Het
Gpha2 T A 19: 6,227,112 I81N possibly damaging Het
Gspt1 C A 16: 11,224,542 V493L probably benign Het
Igsf10 C A 3: 59,325,510 C1934F probably damaging Het
Irgm1 T C 11: 48,866,886 T49A probably benign Het
Klc4 A G 17: 46,640,062 I207T possibly damaging Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Lama1 T C 17: 67,802,987 V2201A possibly damaging Het
Lilrb4a T A 10: 51,491,649 Y96N probably damaging Het
Lrfn2 A G 17: 49,096,351 T501A probably damaging Het
Lrriq1 A G 10: 103,215,757 I378T probably damaging Het
Mphosph8 T C 14: 56,668,353 M1T probably null Het
Nsd1 T C 13: 55,313,132 S2391P possibly damaging Het
Ogdhl G A 14: 32,342,061 G647D probably benign Het
Olfr480 T C 7: 108,066,742 I19V probably benign Het
Olfr813 A G 10: 129,857,192 K225E probably benign Het
Pbrm1 T A 14: 31,050,111 H387Q probably benign Het
Pdgfrb C A 18: 61,081,939 Y1013* probably null Het
Pitrm1 T C 13: 6,565,054 V562A probably damaging Het
Pnpla8 T C 12: 44,283,028 V121A possibly damaging Het
Psd4 T C 2: 24,401,557 L639P probably damaging Het
Psmc3 G T 2: 91,054,630 R47L probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sesn2 A G 4: 132,502,570 V50A probably benign Het
Slc6a16 G A 7: 45,261,148 G377S probably damaging Het
Slitrk1 A G 14: 108,912,022 F419S probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Spata31d1a T A 13: 59,706,320 probably benign Homo
Tgoln1 A T 6: 72,616,001 D165E possibly damaging Het
Tmprss15 T A 16: 79,024,378 T492S probably benign Het
Ttc37 C T 13: 76,118,291 T219M probably benign Het
Zc3h13 T A 14: 75,337,409 M1565K probably damaging Het
Zcwpw1 T C 5: 137,812,036 V358A possibly damaging Het
Zfp607a A G 7: 27,878,582 H359R probably damaging Het
Zzef1 T A 11: 72,855,383 V837E probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCTCGAAGATGCAGTG -3'
(R):5'- CCATACCCTGTTTGGTTCTGGG -3'

Sequencing Primer
(F):5'- CTCCTCGAAGATGCAGTGATGGG -3'
(R):5'- ATACTGTACCACATCATCTGGCAGG -3'
Posted On2018-02-28