Incidental Mutation 'R6224:Ogdhl'
ID504216
Institutional Source Beutler Lab
Gene Symbol Ogdhl
Ensembl Gene ENSMUSG00000021913
Gene Nameoxoglutarate dehydrogenase-like
Synonyms
MMRRC Submission 044355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6224 (G1)
Quality Score182.009
Status Validated
Chromosome14
Chromosomal Location32322019-32348151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32342061 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 647 (G647D)
Ref Sequence ENSEMBL: ENSMUSP00000022480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022480] [ENSMUST00000228529]
Predicted Effect probably benign
Transcript: ENSMUST00000022480
AA Change: G647D

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022480
Gene: ENSMUSG00000021913
AA Change: G647D

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 44 81 2.7e-18 PFAM
Blast:Transket_pyr 118 154 8e-14 BLAST
Pfam:E1_dh 262 588 1.8e-88 PFAM
Transket_pyr 657 870 2.64e-51 SMART
Pfam:OxoGdeHyase_C 874 1019 8.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228529
AA Change: G628D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to oxoglutarate dehydrogenase (OGDH) of the OGDH complex, which degrades glucose and glutamate. This gene encodes several isoforms, including some that appear to localize to mitochondria. The encoded protein down-regulates the AKT signaling cascade and can suppress the growth of cervical cancer cells. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A C 11: 99,838,014 M1R probably null Het
4930505A04Rik A C 11: 30,454,815 N29K probably benign Het
Adamtsl4 T C 3: 95,681,729 Y464C probably damaging Het
Asgr2 T C 11: 70,098,246 V172A probably damaging Het
Atad1 T C 19: 32,698,628 Y132C probably damaging Het
Bpifa6 G A 2: 153,987,153 R200H probably damaging Het
Brd1 A T 15: 88,688,355 M1171K possibly damaging Het
Cadm2 A T 16: 66,664,395 L392Q probably damaging Het
Ccdc183 C T 2: 25,610,582 E333K possibly damaging Het
Cenpe T C 3: 135,243,775 I1335T possibly damaging Het
Cpxm2 T C 7: 132,143,731 N122D probably benign Het
Crls1 T A 2: 132,849,850 probably null Het
Cyp46a1 T C 12: 108,361,560 F460S probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcps T A 9: 35,136,481 T128S probably benign Het
Dcun1d3 A T 7: 119,859,491 L107* probably null Het
Eml1 T C 12: 108,514,508 F397S probably damaging Het
Fanca T A 8: 123,305,281 H348L possibly damaging Het
Foxo1 T A 3: 52,345,672 S419T probably benign Het
Gli3 T C 13: 15,725,145 V1039A probably benign Het
Gm5741 A T 8: 85,067,591 *73R probably null Het
Gp6 A T 7: 4,394,212 F75I probably benign Het
Gpha2 T A 19: 6,227,112 I81N possibly damaging Het
Gspt1 C A 16: 11,224,542 V493L probably benign Het
Igsf10 C A 3: 59,325,510 C1934F probably damaging Het
Irgm1 T C 11: 48,866,886 T49A probably benign Het
Klc4 A G 17: 46,640,062 I207T possibly damaging Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Lama1 T C 17: 67,802,987 V2201A possibly damaging Het
Lilrb4a T A 10: 51,491,649 Y96N probably damaging Het
Lrfn2 A G 17: 49,096,351 T501A probably damaging Het
Lrriq1 A G 10: 103,215,757 I378T probably damaging Het
Mphosph8 T C 14: 56,668,353 M1T probably null Het
Nsd1 T C 13: 55,313,132 S2391P possibly damaging Het
Olfr480 T C 7: 108,066,742 I19V probably benign Het
Olfr813 A G 10: 129,857,192 K225E probably benign Het
Pbrm1 T A 14: 31,050,111 H387Q probably benign Het
Pdgfrb C A 18: 61,081,939 Y1013* probably null Het
Pitrm1 T C 13: 6,565,054 V562A probably damaging Het
Pnpla8 T C 12: 44,283,028 V121A possibly damaging Het
Psd4 T C 2: 24,401,557 L639P probably damaging Het
Psmc3 G T 2: 91,054,630 R47L probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sesn2 A G 4: 132,502,570 V50A probably benign Het
Slc6a16 G A 7: 45,261,148 G377S probably damaging Het
Slitrk1 A G 14: 108,912,022 F419S probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Spata31d1a T A 13: 59,706,320 probably benign Homo
Tgoln1 A T 6: 72,616,001 D165E possibly damaging Het
Tmprss15 T A 16: 79,024,378 T492S probably benign Het
Ttc37 C T 13: 76,118,291 T219M probably benign Het
Zc3h13 T A 14: 75,337,409 M1565K probably damaging Het
Zcwpw1 T C 5: 137,812,036 V358A possibly damaging Het
Zfp607a A G 7: 27,878,582 H359R probably damaging Het
Zzef1 T A 11: 72,855,383 V837E probably damaging Het
Other mutations in Ogdhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Ogdhl APN 14 32333712 missense probably damaging 1.00
IGL00425:Ogdhl APN 14 32346490 missense probably damaging 1.00
IGL01509:Ogdhl APN 14 32337759 missense probably damaging 1.00
IGL01704:Ogdhl APN 14 32337631 splice site probably benign
IGL01760:Ogdhl APN 14 32339937 missense probably damaging 1.00
IGL02376:Ogdhl APN 14 32343318 missense probably damaging 1.00
IGL02508:Ogdhl APN 14 32345174 missense probably damaging 0.99
IGL02834:Ogdhl APN 14 32325946 missense probably damaging 1.00
IGL03100:Ogdhl APN 14 32342072 missense probably benign 0.03
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0207:Ogdhl UTSW 14 32342037 splice site probably null
R0322:Ogdhl UTSW 14 32337577 missense probably benign 0.09
R0357:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R0417:Ogdhl UTSW 14 32326979 missense probably damaging 1.00
R0677:Ogdhl UTSW 14 32339925 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1541:Ogdhl UTSW 14 32340667 missense possibly damaging 0.80
R1589:Ogdhl UTSW 14 32325865 missense probably benign
R1831:Ogdhl UTSW 14 32337527 missense probably damaging 0.99
R2059:Ogdhl UTSW 14 32332884 missense probably damaging 1.00
R2133:Ogdhl UTSW 14 32325934 missense probably benign
R2179:Ogdhl UTSW 14 32335345 missense probably damaging 0.99
R2656:Ogdhl UTSW 14 32332826 missense possibly damaging 0.89
R3607:Ogdhl UTSW 14 32335361 missense probably damaging 1.00
R4617:Ogdhl UTSW 14 32325885 missense probably benign
R4668:Ogdhl UTSW 14 32332536 missense probably benign 0.00
R5419:Ogdhl UTSW 14 32339224 missense probably damaging 1.00
R5575:Ogdhl UTSW 14 32325847 missense possibly damaging 0.60
R5793:Ogdhl UTSW 14 32332773 missense probably damaging 0.96
R5812:Ogdhl UTSW 14 32332865 missense probably damaging 1.00
R5990:Ogdhl UTSW 14 32327114 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCTTTGGAGAGGAAGCTCAGATC -3'
(R):5'- TTAACCCTGGGATGCCTGTG -3'

Sequencing Primer
(F):5'- AGGAAGCTCAGATCAGCCCTG -3'
(R):5'- ATCCATGGTCTCAGTGAAGAC -3'
Posted On2018-02-28