Incidental Mutation 'R6226:Ptpn21'
ID504360
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission 044397-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R6226 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98680116 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1028 (F1028L)
Ref Sequence ENSEMBL: ENSMUSP00000126975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably benign
Transcript: ENSMUST00000085116
AA Change: F1028L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: F1028L

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170188
AA Change: F1028L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: F1028L

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably benign
Transcript: ENSMUST00000221932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223321
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,278,967 T62A probably benign Het
Adam33 G A 2: 131,055,610 T265I probably damaging Het
Afap1l2 T C 19: 56,916,128 T654A probably benign Het
Agrn A G 4: 156,173,609 S992P probably damaging Het
Anapc1 A G 2: 128,650,372 F939L probably damaging Het
Anks1 G A 17: 28,057,330 V1016I probably benign Het
Ankzf1 A G 1: 75,196,594 T401A probably benign Het
Atad1 G T 19: 32,701,587 D105E probably benign Het
AU019823 T C 9: 50,607,770 T181A possibly damaging Het
Carmil2 A G 8: 105,689,032 T313A possibly damaging Het
Cdk15 T C 1: 59,265,633 V131A probably damaging Het
Cldnd1 A T 16: 58,731,300 probably null Het
Col16a1 A T 4: 130,055,089 probably benign Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Dnah7b A C 1: 46,126,668 K498Q probably benign Het
Dnase2b A G 3: 146,584,563 Y218H probably benign Het
Dsg2 T A 18: 20,579,449 V170D probably damaging Het
Dst T C 1: 34,270,874 V1543A probably damaging Het
Ell3 A T 2: 121,441,777 I72K probably damaging Het
Fank1 A G 7: 133,862,198 Y41C probably benign Het
Foxd3 T C 4: 99,657,024 Y134H probably damaging Het
Frmd6 A G 12: 70,863,911 probably benign Het
Gale A G 4: 135,965,605 E53G possibly damaging Het
Glis3 A G 19: 28,317,302 S699P probably damaging Het
Gm12830 T A 4: 114,845,049 M136K unknown Het
Grik3 T C 4: 125,659,789 V438A probably benign Het
Gsap A G 5: 21,217,431 N133D probably damaging Het
Gsg1 T A 6: 135,240,112 D239V probably damaging Het
H2-T10 A T 17: 36,121,083 W23R probably damaging Het
Itgae A G 11: 73,140,757 T1100A probably benign Het
Kcnh7 A T 2: 62,777,559 F559L probably damaging Het
Kdm5b G T 1: 134,608,878 R612L probably damaging Het
Lrrc74a T A 12: 86,748,457 N253K possibly damaging Het
Mcm3ap A G 10: 76,515,706 H1961R possibly damaging Het
Ncam1 C T 9: 49,565,004 E262K probably benign Het
Nckap1 A G 2: 80,508,781 S968P possibly damaging Het
Nr2f2 T G 7: 70,359,996 S112R probably benign Het
Nup93 T C 8: 94,286,537 W137R probably damaging Het
Olfr1115 A G 2: 87,252,392 S152G probably benign Het
Olfr1251 A T 2: 89,666,989 L299H probably damaging Het
Olfr1395 A G 11: 49,148,833 D192G possibly damaging Het
Olfr664 A T 7: 104,734,036 F109L probably damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Olfr922 T C 9: 38,816,370 I289T probably damaging Het
Otogl A T 10: 107,771,206 Y2105* probably null Het
Pibf1 A G 14: 99,101,119 S24G probably damaging Het
Pitx2 C T 3: 129,215,842 R130W probably damaging Het
Pkd1l1 T C 11: 8,901,287 N715S probably benign Het
Pou6f2 A T 13: 18,129,154 I123N possibly damaging Het
Prss29 T A 17: 25,320,539 H35Q possibly damaging Het
Ptprk A G 10: 28,564,103 T856A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl22l1 A G 3: 28,806,527 T13A possibly damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l5 G A 16: 5,176,565 V408I probably damaging Het
Serpina5 T C 12: 104,101,778 S33P possibly damaging Het
Sgip1 A G 4: 102,966,195 N524S probably damaging Het
Shkbp1 C A 7: 27,351,980 R218M probably null Het
Sorcs1 T A 19: 50,181,414 I970F probably damaging Het
Spg11 A G 2: 122,088,262 V962A possibly damaging Het
Sptbn1 A G 11: 30,136,054 M1205T probably damaging Het
Sufu G A 19: 46,473,654 V369M probably damaging Het
Tmem98 T C 11: 80,821,394 F219S probably benign Het
Trim27 T C 13: 21,180,916 probably benign Het
Trim43b T C 9: 89,091,275 E135G possibly damaging Het
Ube2m A G 7: 13,035,888 V110A probably damaging Het
Ugt2b36 A G 5: 87,092,130 V132A probably damaging Het
Usp36 A T 11: 118,277,274 S86T probably damaging Het
Zfp941 A T 7: 140,812,485 D320E probably benign Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAAAGGAAGCTGCCTATAAA -3'
(R):5'- TCCAGAGAGCTGCTAAGGTTAA -3'

Sequencing Primer
(F):5'- GGAAGCTGCCTATAAACAAAGAC -3'
(R):5'- GCACCCAGAGTTAATCTTTAGTGAG -3'
Posted On2018-02-28