Incidental Mutation 'R6227:Naca'
ID504415
Institutional Source Beutler Lab
Gene Symbol Naca
Ensembl Gene ENSMUSG00000061315
Gene Namenascent polypeptide-associated complex alpha polypeptide
SynonymsLOC380777, skNAC
MMRRC Submission
Accession Numbers

Genbank: NM_013608; MGI: 106095 ; Ensembl: ENSMUST00000092048

Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128035575-128048637 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 128043916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073868] [ENSMUST00000092048]
Predicted Effect probably benign
Transcript: ENSMUST00000073868
SMART Domains Protein: ENSMUSP00000073532
Gene: ENSMUSG00000061315

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAC 73 130 3.9e-27 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092048
AA Change: S1606A
SMART Domains Protein: ENSMUSP00000089680
Gene: ENSMUSG00000061315
AA Change: S1606A

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
low complexity region 704 718 N/A INTRINSIC
low complexity region 937 954 N/A INTRINSIC
low complexity region 976 998 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1349 1370 N/A INTRINSIC
low complexity region 1489 1504 N/A INTRINSIC
low complexity region 1572 1593 N/A INTRINSIC
low complexity region 1636 1670 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1806 1827 N/A INTRINSIC
low complexity region 1889 1926 N/A INTRINSIC
low complexity region 1943 1957 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
low complexity region 2016 2029 N/A INTRINSIC
Pfam:NAC 2045 2101 1.7e-25 PFAM
low complexity region 2129 2150 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a point mutation exhibit decreased bone volume and bone formation associated with accelerated mineralization and immature woven-bone formation. Mice null for the muscle specific isoform die during organogenesis with cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(156) : Targeted, other(1) Gene trapped(155)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Naca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Naca APN 10 128041682 intron probably benign
IGL00990:Naca APN 10 128043800 intron probably benign
IGL01093:Naca APN 10 128048113 missense probably damaging 0.99
IGL01356:Naca APN 10 128041715 intron probably benign
IGL01548:Naca APN 10 128040904 intron probably benign
IGL02089:Naca APN 10 128036489 splice site probably benign
IGL02148:Naca APN 10 128043884 intron probably benign
IGL02494:Naca APN 10 128041310 intron probably benign
IGL02672:Naca APN 10 128040283 intron probably benign
IGL02822:Naca APN 10 128039345 intron probably benign
IGL02904:Naca APN 10 128043290 intron probably benign
IGL02931:Naca APN 10 128047682 missense probably damaging 1.00
IGL02971:Naca APN 10 128041568 intron probably benign
IGL03104:Naca APN 10 128040364 intron probably benign
Sinewy UTSW 10 128048358 missense probably damaging 1.00
D4216:Naca UTSW 10 128044240 missense possibly damaging 0.73
P0042:Naca UTSW 10 128041553 intron probably benign
R0110:Naca UTSW 10 128044790 missense probably benign 0.13
R0220:Naca UTSW 10 128043386 intron probably benign
R0469:Naca UTSW 10 128044790 missense probably benign 0.13
R0528:Naca UTSW 10 128043293 missense probably benign 0.23
R0594:Naca UTSW 10 128040355 intron probably benign
R0626:Naca UTSW 10 128041162 intron probably benign
R0885:Naca UTSW 10 128040179 nonsense probably null
R1129:Naca UTSW 10 128040202 intron probably benign
R1437:Naca UTSW 10 128042179 intron probably benign
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1509:Naca UTSW 10 128043397 intron probably benign
R1561:Naca UTSW 10 128040398 intron probably benign
R1574:Naca UTSW 10 128040398 intron probably benign
R1678:Naca UTSW 10 128043526 intron probably benign
R1901:Naca UTSW 10 128043721 intron probably benign
R2884:Naca UTSW 10 128041678 intron probably benign
R2886:Naca UTSW 10 128041678 intron probably benign
R3176:Naca UTSW 10 128040661 intron probably benign
R3276:Naca UTSW 10 128040661 intron probably benign
R4227:Naca UTSW 10 128041661 intron probably benign
R4388:Naca UTSW 10 128044792 missense probably damaging 0.99
R4402:Naca UTSW 10 128043472 intron probably benign
R4798:Naca UTSW 10 128047803 missense probably null 0.99
R4955:Naca UTSW 10 128042215 intron probably benign
R4996:Naca UTSW 10 128042429 intron probably benign
R5027:Naca UTSW 10 128048121 missense possibly damaging 0.63
R5580:Naca UTSW 10 128040593 intron probably benign
R5752:Naca UTSW 10 128041928 intron probably benign
R5788:Naca UTSW 10 128040142 intron probably benign
R6156:Naca UTSW 10 128039291 intron probably benign
R6317:Naca UTSW 10 128044124 missense probably benign 0.33
R6665:Naca UTSW 10 128048358 missense probably damaging 1.00
R7170:Naca UTSW 10 128040121 missense unknown
R7247:Naca UTSW 10 128042598 missense unknown
X0053:Naca UTSW 10 128048255 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACAGGAAGTTGCTGTCTCC -3'
(R):5'- AGCTGTTTGAGGAGCTGCAG -3'

Sequencing Primer
(F):5'- ACAGGAAGTTGCTGTCTCCTCAAG -3'
(R):5'- CTGCAGTAGCTGGGGAAAG -3'
Posted On2018-02-28