Incidental Mutation 'R6228:Spag17'
ID504456
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R6228 (G1)
Quality Score181.009
Status Validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100022602 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 539 (Q539L)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152586
Predicted Effect probably benign
Transcript: ENSMUST00000164539
AA Change: Q539L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Q539L

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CACTTGTGCTCCAGAAACTTC -3'
(R):5'- ATTGGGTATCAGCCAAAGCAAG -3'

Sequencing Primer
(F):5'- TGTCATCCTCAATTACTTGTGATG -3'
(R):5'- GATACTCACCGTTCGTACAGAAATG -3'
Posted On2018-02-28