Incidental Mutation 'R6228:Ep400'
ID504467
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
MMRRC Submission 044357-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6228 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110670942 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2621 (V2621A)
Ref Sequence ENSEMBL: ENSMUSP00000108054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
Predicted Effect probably damaging
Transcript: ENSMUST00000041558
AA Change: V2740A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: V2740A

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112435
AA Change: V2621A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: V2621A

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112436
AA Change: V2704A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: V2704A

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184384
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 intron probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 intron probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCTGTGCAATCCTAGCAC -3'
(R):5'- TCAATGCCCACGTCGAAGTG -3'

Sequencing Primer
(F):5'- GTGCAATCCTAGCACTTTGAG -3'
(R):5'- CTGCATATCAGCTCATGTACAGG -3'
Posted On2018-02-28