Incidental Mutation 'R6228:Rgs6'
ID504490
Institutional Source Beutler Lab
Gene Symbol Rgs6
Ensembl Gene ENSMUSG00000021219
Gene Nameregulator of G-protein signaling 6
Synonyms
MMRRC Submission 044357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6228 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location82588292-83162056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83065964 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 183 (K183E)
Ref Sequence ENSEMBL: ENSMUSP00000125256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101234] [ENSMUST00000161801] [ENSMUST00000185665] [ENSMUST00000185674] [ENSMUST00000186081] [ENSMUST00000186309] [ENSMUST00000186323] [ENSMUST00000186458] [ENSMUST00000186848] [ENSMUST00000191107] [ENSMUST00000191311] [ENSMUST00000191352] [ENSMUST00000200911] [ENSMUST00000201271] [ENSMUST00000202210]
Predicted Effect probably damaging
Transcript: ENSMUST00000101234
AA Change: K183E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098793
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161801
AA Change: K183E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125256
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185665
AA Change: K183E

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139566
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185674
AA Change: K183E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139940
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186081
AA Change: K183E

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140188
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
low complexity region 417 425 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186309
AA Change: K183E

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140701
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
low complexity region 494 499 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186323
AA Change: K183E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141079
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186458
AA Change: K183E

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139735
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186848
AA Change: K148E

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141044
Gene: ENSMUSG00000021219
AA Change: K148E

DomainStartEndE-ValueType
DEP 5 80 1.6e-26 SMART
G_gamma 220 284 1.1e-27 SMART
GGL 223 284 8.8e-30 SMART
RGS 301 416 7.6e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187556
Predicted Effect probably benign
Transcript: ENSMUST00000191107
AA Change: K183E

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139725
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191311
AA Change: K183E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140723
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191352
AA Change: K183E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139718
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200911
AA Change: K183E

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143801
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201271
AA Change: K183E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144139
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 1.6e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202210
AA Change: K183E

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143961
Gene: ENSMUSG00000021219
AA Change: K183E

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype FUNCTION: This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP (Dishevelled, Egl-10, and Pleckstrin) and GGL (G-protein gamma like)domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Mice lacking this gene exhibit decreased heart rate. Alternative splicing results in multiple transcript variants, however, the full-length nature of some of these variants is not known. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased heart rate and abnormal impulse conducting system conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Rgs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Rgs6 APN 12 83051323 missense probably benign 0.01
IGL02131:Rgs6 APN 12 83069495 missense probably damaging 1.00
IGL02354:Rgs6 APN 12 82618619 intron probably benign
IGL02361:Rgs6 APN 12 82618619 intron probably benign
IGL02568:Rgs6 APN 12 83070602 missense probably benign 0.25
IGL02598:Rgs6 APN 12 83091797 missense probably benign 0.02
IGL03146:Rgs6 APN 12 83052538 missense probably damaging 1.00
IGL03248:Rgs6 APN 12 83052550 splice site probably benign
IGL03098:Rgs6 UTSW 12 82985376 missense probably damaging 1.00
IGL03147:Rgs6 UTSW 12 83091846 missense probably damaging 0.99
PIT4453001:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R0270:Rgs6 UTSW 12 83133689 missense probably damaging 1.00
R0390:Rgs6 UTSW 12 83133677 missense probably damaging 1.00
R0540:Rgs6 UTSW 12 83059804 nonsense probably null
R0630:Rgs6 UTSW 12 83047550 splice site probably benign
R1479:Rgs6 UTSW 12 83116244 missense probably damaging 1.00
R1533:Rgs6 UTSW 12 83091773 missense probably benign 0.00
R1545:Rgs6 UTSW 12 83116177 missense probably damaging 0.99
R2161:Rgs6 UTSW 12 83091804 missense probably damaging 1.00
R2421:Rgs6 UTSW 12 83116283 missense possibly damaging 0.93
R4089:Rgs6 UTSW 12 83063487 missense probably damaging 1.00
R4573:Rgs6 UTSW 12 83066015 missense probably damaging 1.00
R4821:Rgs6 UTSW 12 83067411 critical splice acceptor site probably null
R7023:Rgs6 UTSW 12 83092104 intron probably benign
Predicted Primers PCR Primer
(F):5'- GATCTTCATACCTCGCATGGGC -3'
(R):5'- TCAACGCTCCTAAGGAAGAGTC -3'

Sequencing Primer
(F):5'- CATGGGCGACTCTGCTTCTG -3'
(R):5'- CTCCTAAGGAAGAGTCATGTGGTCAC -3'
Posted On2018-02-28