Incidental Mutation 'R6228:Golga5'
ID504491
Institutional Source Beutler Lab
Gene Symbol Golga5
Ensembl Gene ENSMUSG00000021192
Gene Namegolgi autoantigen, golgin subfamily a, 5
SynonymsRet-II
MMRRC Submission 044357-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6228 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location102469135-102497907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102484481 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 464 (M464I)
Ref Sequence ENSEMBL: ENSMUSP00000137305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021609] [ENSMUST00000179218]
Predicted Effect probably benign
Transcript: ENSMUST00000021609
AA Change: M464I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021609
Gene: ENSMUSG00000021192
AA Change: M464I

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179218
AA Change: M464I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137305
Gene: ENSMUSG00000021192
AA Change: M464I

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000222744
AA Change: M8I
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein is a coiled-coil membrane protein that has been postulated to play a role in vesicle tethering and docking. Translocations involving this gene and the ret proto-oncogene have been found in tumor tissues; the chimeric sequences have been designated RET-II and PTC5. A pseudogene of this gene is located on the short arm of chromosome 5. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout does not result in an obvious phenotype and does not affect Golgi apparatus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Golga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Golga5 APN 12 102493814 missense probably damaging 0.99
IGL01487:Golga5 APN 12 102495696 intron probably benign
IGL01585:Golga5 APN 12 102479695 missense probably benign
IGL01901:Golga5 APN 12 102479802 critical splice donor site probably null
IGL02063:Golga5 APN 12 102472159 missense probably benign 0.00
IGL02118:Golga5 APN 12 102495752 missense possibly damaging 0.67
IGL02568:Golga5 APN 12 102472079 missense probably benign 0.33
FR4976:Golga5 UTSW 12 102475660 intron probably null
R0244:Golga5 UTSW 12 102476188 missense probably benign
R0432:Golga5 UTSW 12 102476208 missense possibly damaging 0.50
R0552:Golga5 UTSW 12 102484493 missense possibly damaging 0.75
R0659:Golga5 UTSW 12 102476208 missense possibly damaging 0.50
R1244:Golga5 UTSW 12 102472295 missense probably benign 0.01
R1542:Golga5 UTSW 12 102474720 missense probably damaging 1.00
R1791:Golga5 UTSW 12 102492131 missense possibly damaging 0.48
R2310:Golga5 UTSW 12 102492161 missense probably damaging 0.99
R5110:Golga5 UTSW 12 102472077 missense probably benign 0.02
R5704:Golga5 UTSW 12 102489448 missense probably benign 0.00
R6229:Golga5 UTSW 12 102484481 missense probably benign 0.00
R6241:Golga5 UTSW 12 102472473 missense probably damaging 0.96
R7236:Golga5 UTSW 12 102474775 critical splice donor site probably null
R7355:Golga5 UTSW 12 102472235 missense possibly damaging 0.83
R7404:Golga5 UTSW 12 102484519 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTGCTCAGTCTCTGGCATC -3'
(R):5'- CCTCTTGGAGTTAGTCAACAGAC -3'

Sequencing Primer
(F):5'- CTGTGGTAACCAGACCTTCATATGG -3'
(R):5'- TCTTGGAGTTAGTCAACAGACAAACC -3'
Posted On2018-02-28