Incidental Mutation 'R6229:Cmya5'
ID504575
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 044358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6229 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93093306 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1758 (V1758G)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: V1758G

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: V1758G

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224009
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G A 1: 120,171,483 probably null Het
Adamts6 G A 13: 104,347,392 probably null Het
Add3 C A 19: 53,234,846 A343D probably benign Het
Ankub1 T C 3: 57,665,107 D398G probably benign Het
Apbb1 C T 7: 105,573,730 A225T probably damaging Het
Apbb1 C A 7: 105,573,731 W224C probably damaging Het
Arhgef40 A T 14: 51,990,090 Q431L probably benign Het
Calm4 A G 13: 3,838,038 D48G possibly damaging Het
Ccdc18 A T 5: 108,171,618 I502L probably benign Het
Cftr T C 6: 18,220,684 S185P probably damaging Het
Chd2 C A 7: 73,451,723 K1418N possibly damaging Het
Cpsf4l T C 11: 113,708,854 K35R possibly damaging Het
Cyp2c68 A T 19: 39,739,178 V119E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah3 G T 7: 119,965,488 Q2651K probably benign Het
Eif4g2 T C 7: 111,077,713 probably null Het
Enc1 A G 13: 97,245,491 R170G probably benign Het
Enpp2 T C 15: 54,877,832 R357G probably damaging Het
Epb41l2 A G 10: 25,499,836 K58E possibly damaging Het
Fis1 A G 5: 136,965,674 probably null Het
Fmo9 A C 1: 166,677,557 M89R possibly damaging Het
Gm13119 T C 4: 144,363,629 M413T probably benign Het
Gm6096 A C 7: 34,251,251 I72L possibly damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Got1l1 T C 8: 27,198,436 probably null Het
Igfbpl1 A G 4: 45,813,517 Y233H probably damaging Het
Il18r1 T C 1: 40,474,763 I43T probably benign Het
Ints8 T C 4: 11,252,891 N64D probably damaging Het
Kalrn A G 16: 34,055,071 S44P probably damaging Het
Kif13b G T 14: 64,738,567 G444W probably damaging Het
Lmo1 A G 7: 109,143,625 C13R probably damaging Het
Lrfn2 T A 17: 49,097,132 M761K possibly damaging Het
Lrrd1 T C 5: 3,863,887 I719T probably damaging Het
Madd A T 2: 91,143,670 V1423E probably damaging Het
Mbnl1 T A 3: 60,621,328 probably null Het
Mrps28 T C 3: 8,900,037 D114G probably damaging Het
Muc6 T A 7: 141,640,525 M1412L probably benign Het
Myf6 T C 10: 107,494,419 K96E possibly damaging Het
Myrf A G 19: 10,219,798 V462A probably benign Het
Nbeal1 T C 1: 60,248,365 S923P possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nfatc2ip C T 7: 126,395,941 probably null Het
Olfr1145 G T 2: 87,810,087 C89F probably damaging Het
Olfr1362 T C 13: 21,611,649 I107V probably benign Het
Olfr739 A G 14: 50,425,205 R229G probably benign Het
Olfr853 T A 9: 19,537,718 I71F possibly damaging Het
Plin2 A G 4: 86,668,666 V5A probably benign Het
Ptprm T A 17: 66,688,300 D1311V probably damaging Het
Recql5 A T 11: 115,930,714 I72N probably damaging Het
Sall2 A T 14: 52,313,191 M847K probably benign Het
Slc23a1 T C 18: 35,619,524 R567G probably benign Het
Slc28a1 G A 7: 81,125,005 R200H probably benign Het
Smc4 T A 3: 69,030,247 Y843* probably null Het
Syne2 C A 12: 75,921,220 Q915K probably benign Het
Tas2r131 T A 6: 132,957,022 I275F probably damaging Het
Tcf20 T C 15: 82,854,880 H790R probably damaging Het
Tm7sf3 A G 6: 146,613,389 F310S possibly damaging Het
Tmem9b T A 7: 109,745,420 probably null Het
Tnfaip8 A G 18: 50,051,675 probably benign Het
Top2b T G 14: 16,409,838 L835R probably damaging Het
Trappc8 A T 18: 20,870,745 S209T probably benign Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Uap1 C T 1: 170,166,733 R58Q probably benign Het
Upk3bl A G 5: 136,064,061 probably null Het
Usp34 A G 11: 23,446,778 H596R probably damaging Het
Vmn1r181 C T 7: 23,984,155 A15V probably damaging Het
Vmn2r54 T A 7: 12,631,956 K350N probably benign Het
Vmn2r89 A G 14: 51,455,721 H176R probably benign Het
Vwa7 A G 17: 35,024,265 R640G probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense not run
R7088:Cmya5 UTSW 13 93091864 missense not run
R7126:Cmya5 UTSW 13 93089940 missense not run
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATAGCTTCTCACCAGACACTG -3'
(R):5'- AGCCTAAACGGACCCTTCATG -3'

Sequencing Primer
(F):5'- CCAGACACTGGTGCTTTGC -3'
(R):5'- TTCATGAGGGCCAAGCTG -3'
Posted On2018-02-28