Incidental Mutation 'R6229:Olfr739'
ID504579
Institutional Source Beutler Lab
Gene Symbol Olfr739
Ensembl Gene ENSMUSG00000057903
Gene Nameolfactory receptor 739
SynonymsMOR106-2, GA_x6K02T2PMLR-6121675-6122604
MMRRC Submission 044358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6229 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50418626-50427888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50425205 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 229 (R229G)
Ref Sequence ENSEMBL: ENSMUSP00000150559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075261] [ENSMUST00000216949]
Predicted Effect probably benign
Transcript: ENSMUST00000075261
AA Change: R229G

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074740
Gene: ENSMUSG00000057903
AA Change: R229G

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.1e-53 PFAM
Pfam:7tm_1 43 292 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216949
AA Change: R229G

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G A 1: 120,171,483 probably null Het
Adamts6 G A 13: 104,347,392 probably null Het
Add3 C A 19: 53,234,846 A343D probably benign Het
Ankub1 T C 3: 57,665,107 D398G probably benign Het
Apbb1 C T 7: 105,573,730 A225T probably damaging Het
Apbb1 C A 7: 105,573,731 W224C probably damaging Het
Arhgef40 A T 14: 51,990,090 Q431L probably benign Het
Calm4 A G 13: 3,838,038 D48G possibly damaging Het
Ccdc18 A T 5: 108,171,618 I502L probably benign Het
Cftr T C 6: 18,220,684 S185P probably damaging Het
Chd2 C A 7: 73,451,723 K1418N possibly damaging Het
Cmya5 A C 13: 93,093,306 V1758G probably benign Het
Cpsf4l T C 11: 113,708,854 K35R possibly damaging Het
Cyp2c68 A T 19: 39,739,178 V119E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah3 G T 7: 119,965,488 Q2651K probably benign Het
Eif4g2 T C 7: 111,077,713 probably null Het
Enc1 A G 13: 97,245,491 R170G probably benign Het
Enpp2 T C 15: 54,877,832 R357G probably damaging Het
Epb41l2 A G 10: 25,499,836 K58E possibly damaging Het
Fis1 A G 5: 136,965,674 probably null Het
Fmo9 A C 1: 166,677,557 M89R possibly damaging Het
Gm13119 T C 4: 144,363,629 M413T probably benign Het
Gm6096 A C 7: 34,251,251 I72L possibly damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Got1l1 T C 8: 27,198,436 probably null Het
Igfbpl1 A G 4: 45,813,517 Y233H probably damaging Het
Il18r1 T C 1: 40,474,763 I43T probably benign Het
Ints8 T C 4: 11,252,891 N64D probably damaging Het
Kalrn A G 16: 34,055,071 S44P probably damaging Het
Kif13b G T 14: 64,738,567 G444W probably damaging Het
Lmo1 A G 7: 109,143,625 C13R probably damaging Het
Lrfn2 T A 17: 49,097,132 M761K possibly damaging Het
Lrrd1 T C 5: 3,863,887 I719T probably damaging Het
Madd A T 2: 91,143,670 V1423E probably damaging Het
Mbnl1 T A 3: 60,621,328 probably null Het
Mrps28 T C 3: 8,900,037 D114G probably damaging Het
Muc6 T A 7: 141,640,525 M1412L probably benign Het
Myf6 T C 10: 107,494,419 K96E possibly damaging Het
Myrf A G 19: 10,219,798 V462A probably benign Het
Nbeal1 T C 1: 60,248,365 S923P possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nfatc2ip C T 7: 126,395,941 probably null Het
Olfr1145 G T 2: 87,810,087 C89F probably damaging Het
Olfr1362 T C 13: 21,611,649 I107V probably benign Het
Olfr853 T A 9: 19,537,718 I71F possibly damaging Het
Plin2 A G 4: 86,668,666 V5A probably benign Het
Ptprm T A 17: 66,688,300 D1311V probably damaging Het
Recql5 A T 11: 115,930,714 I72N probably damaging Het
Sall2 A T 14: 52,313,191 M847K probably benign Het
Slc23a1 T C 18: 35,619,524 R567G probably benign Het
Slc28a1 G A 7: 81,125,005 R200H probably benign Het
Smc4 T A 3: 69,030,247 Y843* probably null Het
Syne2 C A 12: 75,921,220 Q915K probably benign Het
Tas2r131 T A 6: 132,957,022 I275F probably damaging Het
Tcf20 T C 15: 82,854,880 H790R probably damaging Het
Tm7sf3 A G 6: 146,613,389 F310S possibly damaging Het
Tmem9b T A 7: 109,745,420 probably null Het
Tnfaip8 A G 18: 50,051,675 probably benign Het
Top2b T G 14: 16,409,838 L835R probably damaging Het
Trappc8 A T 18: 20,870,745 S209T probably benign Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Uap1 C T 1: 170,166,733 R58Q probably benign Het
Upk3bl A G 5: 136,064,061 probably null Het
Usp34 A G 11: 23,446,778 H596R probably damaging Het
Vmn1r181 C T 7: 23,984,155 A15V probably damaging Het
Vmn2r54 T A 7: 12,631,956 K350N probably benign Het
Vmn2r89 A G 14: 51,455,721 H176R probably benign Het
Vwa7 A G 17: 35,024,265 R640G probably benign Het
Other mutations in Olfr739
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Olfr739 APN 14 50424561 missense possibly damaging 0.88
IGL02430:Olfr739 APN 14 50425151 missense probably benign
IGL02603:Olfr739 APN 14 50425200 missense probably damaging 1.00
IGL02959:Olfr739 APN 14 50424932 missense possibly damaging 0.76
IGL03154:Olfr739 APN 14 50424623 missense probably benign 0.00
R0455:Olfr739 UTSW 14 50424902 missense possibly damaging 0.45
R1984:Olfr739 UTSW 14 50425391 missense possibly damaging 0.93
R3160:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3161:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3162:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R4821:Olfr739 UTSW 14 50424749 missense possibly damaging 0.96
R4880:Olfr739 UTSW 14 50425301 missense possibly damaging 0.90
R5047:Olfr739 UTSW 14 50425239 missense probably damaging 1.00
R5384:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5385:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5386:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5640:Olfr739 UTSW 14 50424654 missense probably benign 0.18
R5809:Olfr739 UTSW 14 50425448 makesense probably null
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6614:Olfr739 UTSW 14 50425089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACCTCTGCAACATCCTTG -3'
(R):5'- CACAGGATTAATGAGTGGAGTAACC -3'

Sequencing Primer
(F):5'- GCAACATCCTTGTGATCAGTTG -3'
(R):5'- CAGATGTTGGGCTCAGAT -3'
Posted On2018-02-28