Incidental Mutation 'R6229:Arhgef40'
ID504581
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission 044358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R6229 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51990090 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 431 (Q431L)
Ref Sequence ENSEMBL: ENSMUSP00000138354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182193] [ENSMUST00000182338] [ENSMUST00000182649] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect probably benign
Transcript: ENSMUST00000093813
AA Change: Q494L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: Q494L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
AA Change: Q494L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: Q494L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182019
Predicted Effect probably benign
Transcript: ENSMUST00000182061
AA Change: Q494L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: Q494L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182193
Predicted Effect probably benign
Transcript: ENSMUST00000182338
SMART Domains Protein: ENSMUSP00000138482
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182609
Predicted Effect probably benign
Transcript: ENSMUST00000182649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182740
Predicted Effect probably benign
Transcript: ENSMUST00000182760
AA Change: Q494L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: Q494L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182905
AA Change: Q494L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: Q494L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182909
AA Change: Q494L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: Q494L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182961
Predicted Effect probably benign
Transcript: ENSMUST00000183208
AA Change: Q431L

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562
AA Change: Q431L

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G A 1: 120,171,483 probably null Het
Adamts6 G A 13: 104,347,392 probably null Het
Add3 C A 19: 53,234,846 A343D probably benign Het
Ankub1 T C 3: 57,665,107 D398G probably benign Het
Apbb1 C T 7: 105,573,730 A225T probably damaging Het
Apbb1 C A 7: 105,573,731 W224C probably damaging Het
Calm4 A G 13: 3,838,038 D48G possibly damaging Het
Ccdc18 A T 5: 108,171,618 I502L probably benign Het
Cftr T C 6: 18,220,684 S185P probably damaging Het
Chd2 C A 7: 73,451,723 K1418N possibly damaging Het
Cmya5 A C 13: 93,093,306 V1758G probably benign Het
Cpsf4l T C 11: 113,708,854 K35R possibly damaging Het
Cyp2c68 A T 19: 39,739,178 V119E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah3 G T 7: 119,965,488 Q2651K probably benign Het
Eif4g2 T C 7: 111,077,713 probably null Het
Enc1 A G 13: 97,245,491 R170G probably benign Het
Enpp2 T C 15: 54,877,832 R357G probably damaging Het
Epb41l2 A G 10: 25,499,836 K58E possibly damaging Het
Fis1 A G 5: 136,965,674 probably null Het
Fmo9 A C 1: 166,677,557 M89R possibly damaging Het
Gm13119 T C 4: 144,363,629 M413T probably benign Het
Gm6096 A C 7: 34,251,251 I72L possibly damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Got1l1 T C 8: 27,198,436 probably null Het
Igfbpl1 A G 4: 45,813,517 Y233H probably damaging Het
Il18r1 T C 1: 40,474,763 I43T probably benign Het
Ints8 T C 4: 11,252,891 N64D probably damaging Het
Kalrn A G 16: 34,055,071 S44P probably damaging Het
Kif13b G T 14: 64,738,567 G444W probably damaging Het
Lmo1 A G 7: 109,143,625 C13R probably damaging Het
Lrfn2 T A 17: 49,097,132 M761K possibly damaging Het
Lrrd1 T C 5: 3,863,887 I719T probably damaging Het
Madd A T 2: 91,143,670 V1423E probably damaging Het
Mbnl1 T A 3: 60,621,328 probably null Het
Mrps28 T C 3: 8,900,037 D114G probably damaging Het
Muc6 T A 7: 141,640,525 M1412L probably benign Het
Myf6 T C 10: 107,494,419 K96E possibly damaging Het
Myrf A G 19: 10,219,798 V462A probably benign Het
Nbeal1 T C 1: 60,248,365 S923P possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nfatc2ip C T 7: 126,395,941 probably null Het
Olfr1145 G T 2: 87,810,087 C89F probably damaging Het
Olfr1362 T C 13: 21,611,649 I107V probably benign Het
Olfr739 A G 14: 50,425,205 R229G probably benign Het
Olfr853 T A 9: 19,537,718 I71F possibly damaging Het
Plin2 A G 4: 86,668,666 V5A probably benign Het
Ptprm T A 17: 66,688,300 D1311V probably damaging Het
Recql5 A T 11: 115,930,714 I72N probably damaging Het
Sall2 A T 14: 52,313,191 M847K probably benign Het
Slc23a1 T C 18: 35,619,524 R567G probably benign Het
Slc28a1 G A 7: 81,125,005 R200H probably benign Het
Smc4 T A 3: 69,030,247 Y843* probably null Het
Syne2 C A 12: 75,921,220 Q915K probably benign Het
Tas2r131 T A 6: 132,957,022 I275F probably damaging Het
Tcf20 T C 15: 82,854,880 H790R probably damaging Het
Tm7sf3 A G 6: 146,613,389 F310S possibly damaging Het
Tmem9b T A 7: 109,745,420 probably null Het
Tnfaip8 A G 18: 50,051,675 probably benign Het
Top2b T G 14: 16,409,838 L835R probably damaging Het
Trappc8 A T 18: 20,870,745 S209T probably benign Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Uap1 C T 1: 170,166,733 R58Q probably benign Het
Upk3bl A G 5: 136,064,061 probably null Het
Usp34 A G 11: 23,446,778 H596R probably damaging Het
Vmn1r181 C T 7: 23,984,155 A15V probably damaging Het
Vmn2r54 T A 7: 12,631,956 K350N probably benign Het
Vmn2r89 A G 14: 51,455,721 H176R probably benign Het
Vwa7 A G 17: 35,024,265 R640G probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTTGACCCCGCAGTGTA -3'
(R):5'- CCCTACTGCTGGGCTACCA -3'

Sequencing Primer
(F):5'- GCAGTGTACGGCAGGTG -3'
(R):5'- TGGGGTTACACATCCATACTAGGC -3'
Posted On2018-02-28