Incidental Mutation 'R6232:Muc16'
ID504683
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission 044360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6232 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18656998 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1408 (N1408K)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: N1408K
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5134 T A 10: 75,986,025 L231Q possibly damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Myh7 T A 14: 54,989,296 Q366L probably benign Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Olfr697 A T 7: 106,741,554 C127S probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pkp1 T A 1: 135,886,861 I241F probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Sec63 T A 10: 42,828,865 probably null Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,170,433 I661V probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense not run
R7515:Muc16 UTSW 9 18639662 missense not run
R7537:Muc16 UTSW 9 18638135 missense not run
R7538:Muc16 UTSW 9 18642131 missense not run
R7538:Muc16 UTSW 9 18655451 missense not run
R7543:Muc16 UTSW 9 18644732 missense not run
R7566:Muc16 UTSW 9 18638629 missense not run
Predicted Primers PCR Primer
(F):5'- ATAAAGAGGGCTTCTCGTCAGG -3'
(R):5'- ATGAAGTCCCATCAATTGCAAC -3'

Sequencing Primer
(F):5'- CAGGGTTCTGCCAGCTCTAATG -3'
(R):5'- ACTGGGCAATTCTCCAGGATATC -3'
Posted On2018-02-28