Incidental Mutation 'R6232:Myh7'
ID504704
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission 044360-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R6232 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54989296 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 366 (Q366L)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102803] [ENSMUST00000153783] [ENSMUST00000168485] [ENSMUST00000226424] [ENSMUST00000227518] [ENSMUST00000228837]
Predicted Effect probably benign
Transcript: ENSMUST00000102803
AA Change: Q366L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: Q366L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149852
Predicted Effect probably benign
Transcript: ENSMUST00000153783
SMART Domains Protein: ENSMUSP00000116595
Gene: ENSMUSG00000053093

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 61 8.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168485
AA Change: Q366L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: Q366L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226424
Predicted Effect probably benign
Transcript: ENSMUST00000227518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228715
Predicted Effect probably benign
Transcript: ENSMUST00000228837
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5134 T A 10: 75,986,025 L231Q possibly damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Muc16 A T 9: 18,656,998 N1408K unknown Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Olfr697 A T 7: 106,741,554 C127S probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pkp1 T A 1: 135,886,861 I241F probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Sec63 T A 10: 42,828,865 probably null Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,170,433 I661V probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0581:Myh7 UTSW 14 54985496 missense probably benign 0.02
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4880:Myh7 UTSW 14 54978588 missense probably benign 0.18
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5004:Myh7 UTSW 14 54971683 missense probably damaging 0.99
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R5957:Myh7 UTSW 14 54989078 missense probably damaging 1.00
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6345:Myh7 UTSW 14 54983692 missense probably damaging 1.00
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6755:Myh7 UTSW 14 54992313 missense possibly damaging 0.71
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7201:Myh7 UTSW 14 54990945 missense possibly damaging 0.58
R7257:Myh7 UTSW 14 54972490 intron probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAAGCAGGTCGGCTGAGTTC -3'
(R):5'- GGGAATCTCATACTTTACAGGGG -3'

Sequencing Primer
(F):5'- TGAGTTCAGCCCCATGAGGTAG -3'
(R):5'- GGAAAACAAATTCAGGTTCTCTCTCC -3'
Posted On2018-02-28