Incidental Mutation 'R6236:Tpp2'
ID504922
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Nametripeptidyl peptidase II
SynonymsTppII
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R6236 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location43933647-44003000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43977317 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 711 (S711T)
Ref Sequence ENSEMBL: ENSMUSP00000139918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]
Predicted Effect probably benign
Transcript: ENSMUST00000087933
AA Change: S711T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: S711T

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect unknown
Transcript: ENSMUST00000186441
AA Change: S219T
Predicted Effect probably benign
Transcript: ENSMUST00000188302
SMART Domains Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 4.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188313
AA Change: S711T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: S711T

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189388
AA Change: S711T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: S711T

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 2.3e-81 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 880 7.8e-49 PFAM
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,207 T703A possibly damaging Het
Acd C T 8: 105,700,495 A49T probably benign Het
Acer1 T A 17: 56,955,231 I224F probably benign Het
Acvr1 T C 2: 58,477,666 D161G probably benign Het
Catsper4 T C 4: 134,221,576 I111V probably benign Het
Ccdc173 A C 2: 69,758,041 probably null Het
Chst14 T A 2: 118,927,516 C264S probably damaging Het
Clnk T C 5: 38,713,199 T339A probably benign Het
Cnot4 T C 6: 35,068,673 K201R probably benign Het
Col19a1 A G 1: 24,279,949 V1020A probably damaging Het
Cts6 C A 13: 61,196,378 E287* probably null Het
Dbf4 T C 5: 8,398,579 probably benign Het
Diaph3 G A 14: 87,037,568 R140* probably null Het
Faah T C 4: 115,999,589 I459V probably benign Het
Fbxw2 A T 2: 34,822,833 L72H probably damaging Het
Fstl4 G A 11: 53,186,335 G640S probably benign Het
Gabrb1 C T 5: 72,108,320 T186M probably damaging Het
Gata2 T C 6: 88,202,566 probably null Het
Ifi203 A G 1: 173,933,913 V190A probably benign Het
Kdm3a T C 6: 71,611,657 E456G probably benign Het
Kl A T 5: 150,953,290 T192S probably damaging Het
Klhl3 G A 13: 58,085,062 A77V probably damaging Het
Klri2 A G 6: 129,738,895 F114L probably benign Het
Lonp2 A T 8: 86,636,587 R278* probably null Het
Lrp5 A T 19: 3,630,483 probably null Het
Med13 T A 11: 86,328,531 H363L probably damaging Het
Metap1d T G 2: 71,515,678 F194L probably benign Het
Misp A G 10: 79,827,122 K458E probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myh2 A G 11: 67,190,331 T1258A probably benign Het
Nipbl T A 15: 8,324,580 D1691V possibly damaging Het
Nr1i2 C T 16: 38,265,938 C55Y probably damaging Het
Olfr746 T C 14: 50,653,800 S188P probably damaging Het
Olfr836 A T 9: 19,121,113 I50F possibly damaging Het
Pcdhgb4 T C 18: 37,721,292 Y247H probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Ric1 T A 19: 29,595,426 D755E possibly damaging Het
Sez6l G T 5: 112,475,244 T147K possibly damaging Het
Ski A G 4: 155,159,544 F451S probably benign Het
Slc45a2 C T 15: 11,022,072 T300I probably benign Het
Smarca2 T C 19: 26,696,213 V1050A probably benign Het
Spag1 T C 15: 36,211,135 S476P probably damaging Het
Sptbn2 T A 19: 4,748,138 S1964T probably benign Het
Sucla2 T A 14: 73,593,750 D434E probably benign Het
Tbl3 G A 17: 24,700,743 T779I probably benign Het
Tlr2 T A 3: 83,838,131 E215V probably benign Het
Tomm40 G A 7: 19,703,356 P227S probably benign Het
Traj32 T A 14: 54,186,108 Y2* probably null Het
Trim34b A G 7: 104,336,318 R387G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp5 T C 6: 124,818,478 T651A probably benign Het
Vmn1r188 T C 13: 22,088,244 S123P probably damaging Het
Zdhhc14 T C 17: 5,493,643 L66P probably damaging Het
Zfp712 C T 13: 67,040,621 C614Y probably damaging Het
Zfp827 A G 8: 79,070,476 K397R probably damaging Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
cleaver UTSW 1 43978508 nonsense probably null
eddie UTSW 1 43968988 missense probably damaging 1.00
June UTSW 1 43954710 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0003:Tpp2 UTSW 1 43960139 missense possibly damaging 0.94
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0441:Tpp2 UTSW 1 43990562 missense possibly damaging 0.85
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1593:Tpp2 UTSW 1 43975433 missense probably benign 0.01
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2066:Tpp2 UTSW 1 43978438 missense possibly damaging 0.48
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2378:Tpp2 UTSW 1 43999765 missense probably damaging 0.99
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6118:Tpp2 UTSW 1 43940146 missense probably damaging 1.00
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7223:Tpp2 UTSW 1 43968888 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
R7324:Tpp2 UTSW 1 43978778 missense probably damaging 1.00
R7363:Tpp2 UTSW 1 43985422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTACAGCTTTACTTTGAAGATCC -3'
(R):5'- GAAGGAAAATTCACTTCTGAAACAC -3'

Sequencing Primer
(F):5'- GAGACCTGGATTTGATTCTCAGCAC -3'
(R):5'- TAGGATCCCTTGGAACTAGAGCTAC -3'
Posted On2018-02-28