Incidental Mutation 'R6237:Galnt5'
ID504980
Institutional Source Beutler Lab
Gene Symbol Galnt5
Ensembl Gene ENSMUSG00000026828
Gene Namepolypeptide N-acetylgalactosaminyltransferase 5
SynonymsppGaNTase-T5
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6237 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location57997884-58045860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58035249 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 847 (W847C)
Ref Sequence ENSEMBL: ENSMUSP00000131362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]
Predicted Effect probably damaging
Transcript: ENSMUST00000112616
AA Change: W847C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: W847C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 1.3e-33 PFAM
Pfam:Glyco_transf_7C 653 718 1.9e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144671
Predicted Effect probably damaging
Transcript: ENSMUST00000166729
AA Change: W847C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: W847C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah3 A C 7: 120,009,384 M1784R probably damaging Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
E2f2 A G 4: 136,178,485 E103G possibly damaging Het
Eef1akmt3 T A 10: 127,033,008 H199L possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Hspa1l C T 17: 34,977,452 Q156* probably null Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Ikzf3 C A 11: 98,467,053 R486L probably damaging Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sbf1 C T 15: 89,293,476 R1642H probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Wnk1 C A 6: 119,952,767 G1263V probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in Galnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Galnt5 APN 2 57998973 missense probably benign
IGL00515:Galnt5 APN 2 57999068 missense probably benign 0.02
IGL00950:Galnt5 APN 2 57999132 missense probably benign 0.00
IGL00973:Galnt5 APN 2 57998939 missense probably benign 0.02
IGL01152:Galnt5 APN 2 58025393 missense probably benign 0.17
IGL01305:Galnt5 APN 2 58025342 nonsense probably null
IGL01661:Galnt5 APN 2 57999482 missense probably benign 0.03
IGL01719:Galnt5 APN 2 57998543 missense probably damaging 1.00
IGL02165:Galnt5 APN 2 57998865 missense probably benign
IGL02795:Galnt5 APN 2 58027871 missense probably damaging 1.00
IGL02943:Galnt5 APN 2 57999768 missense probably damaging 1.00
IGL03218:Galnt5 APN 2 57999389 missense possibly damaging 0.59
ANU22:Galnt5 UTSW 2 58025342 nonsense probably null
R0082:Galnt5 UTSW 2 57999035 missense possibly damaging 0.92
R0113:Galnt5 UTSW 2 57998877 missense probably benign
R0445:Galnt5 UTSW 2 57998950 missense probably benign
R0517:Galnt5 UTSW 2 58035373 splice site probably benign
R0609:Galnt5 UTSW 2 58024625 missense possibly damaging 0.90
R0639:Galnt5 UTSW 2 57999395 missense probably benign 0.07
R0646:Galnt5 UTSW 2 57999085 missense probably benign 0.00
R0677:Galnt5 UTSW 2 57998980 nonsense probably null
R1808:Galnt5 UTSW 2 58026125 missense probably benign 0.24
R1927:Galnt5 UTSW 2 57998603 missense probably benign 0.00
R1980:Galnt5 UTSW 2 58024723 critical splice donor site probably null
R2517:Galnt5 UTSW 2 57999413 missense probably benign 0.00
R4044:Galnt5 UTSW 2 57998460 missense probably damaging 1.00
R4154:Galnt5 UTSW 2 57998493 missense probably damaging 1.00
R4411:Galnt5 UTSW 2 57999195 missense probably benign 0.01
R4703:Galnt5 UTSW 2 57998907 missense possibly damaging 0.96
R4767:Galnt5 UTSW 2 58028144 missense possibly damaging 0.91
R5118:Galnt5 UTSW 2 58015003 missense probably damaging 1.00
R5497:Galnt5 UTSW 2 58025328 missense probably damaging 0.99
R5506:Galnt5 UTSW 2 57999625 missense probably benign
R5548:Galnt5 UTSW 2 58014910 missense probably damaging 0.99
R5758:Galnt5 UTSW 2 57998430 missense probably benign 0.19
R5937:Galnt5 UTSW 2 58038937 missense probably benign 0.00
R6805:Galnt5 UTSW 2 58035299 missense possibly damaging 0.82
R6959:Galnt5 UTSW 2 57999219 missense probably benign 0.39
R7070:Galnt5 UTSW 2 57998609 missense probably benign 0.00
R7179:Galnt5 UTSW 2 57998609 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCCACAGTGATCGTCTTCC -3'
(R):5'- TTCAGACTGGGGAAGTGGAC -3'

Sequencing Primer
(F):5'- GATCGTCTTCCTCTTCAACATAACAG -3'
(R):5'- CAGACTGGGGAAGTGGACTTTGTAG -3'
Posted On2018-02-28