Mutagenetix > Incidental Mutation

Incidental Mutation 'R6237:E2f2'

504988

Institutional Source

Beutler Lab

Gene Symbol

E2f2

Ensembl Gene

ENSMUSG00000018983

Gene Name

E2F transcription factor 2

Synonyms

MMRRC Submission

044362-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

R6237 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135899705-135923368 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135905796 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 103 (E103G)

Ref Sequence

ENSEMBL: ENSMUSP00000050047 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061721]

AlphaFold

P56931

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061721
AA Change: E103G

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000050047
Gene: ENSMUSG00000018983
AA Change: E103G

Domain	Start	End	E-Value	Type
low complexity region	41	54	N/A	INTRINSIC
E2F_TDP	131	196	2.93e-32	SMART
Pfam:E2F_CC-MB	212	306	3.1e-38	PFAM
low complexity region	348	376	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149750

Meta Mutation Damage Score

0.0765

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F1 and E2F3, have an additional cyclin binding domain. This protein binds specifically to retinoblastoma protein pRB in a cell-cycle dependent manner, and it exhibits overall 46% amino acid identity to E2F1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death with signs of inflammatory and autoimmune disorders such as increased memory T cells, enlarged spleen, glomerulonephritis, inflammed liver, inflammed lung, increased double stranded DNA antibodies, hair loss, and erythema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 120,342,502 (GRCm39)	R380H	probably damaging	Het
Akr1c12	C	A	13: 4,325,767 (GRCm39)	D109Y	possibly damaging	Het
Cacna1s	A	T	1: 136,033,582 (GRCm39)	M1020L	possibly damaging	Het
Cbx8	C	A	11: 118,931,213 (GRCm39)	R25L	possibly damaging	Het
Ccdc87	A	G	19: 4,891,407 (GRCm39)	Y633C	probably benign	Het
Col4a4	C	T	1: 82,484,752 (GRCm39)	S505N	unknown	Het
Cr2	T	A	1: 194,839,810 (GRCm39)	H539L	probably damaging	Het
Cyp2b9	T	A	7: 25,872,999 (GRCm39)	D47E	probably benign	Het
Dnah3	A	C	7: 119,608,607 (GRCm39)	M1784R	probably damaging	Het
Dnah8	T	A	17: 30,966,828 (GRCm39)	L2520*	probably null	Het
Eef1akmt3	T	A	10: 126,868,877 (GRCm39)	H199L	possibly damaging	Het
Faxc	A	T	4: 21,993,376 (GRCm39)	N340I	possibly damaging	Het
Fer1l6	A	T	15: 58,497,026 (GRCm39)	R1199*	probably null	Het
Fer1l6	A	G	15: 58,509,855 (GRCm39)	D1439G	probably damaging	Het
Galnt5	G	T	2: 57,925,261 (GRCm39)	W847C	probably damaging	Het
Gbp2	G	A	3: 142,337,793 (GRCm39)	S303N	probably benign	Het
Glipr1l1	A	T	10: 111,896,332 (GRCm39)	K40*	probably null	Het
Gm4353	A	C	7: 115,683,134 (GRCm39)	L149R	possibly damaging	Het
Grk5	A	G	19: 61,078,380 (GRCm39)	D479G	probably damaging	Het
Gzmc	T	A	14: 56,471,486 (GRCm39)		probably null	Het
Hace1	T	C	10: 45,524,986 (GRCm39)	Y251H	probably benign	Het
Hhla1	G	T	15: 65,813,646 (GRCm39)	P229T	probably damaging	Het
Hspa1l	C	T	17: 35,196,428 (GRCm39)	Q156*	probably null	Het
Igkv4-78	A	T	6: 69,036,683 (GRCm39)	Y117N	probably benign	Het
Ikzf3	C	A	11: 98,357,879 (GRCm39)	R486L	probably damaging	Het
Itpr1	C	T	6: 108,355,164 (GRCm39)	T485M	possibly damaging	Het
Kcnab3	T	C	11: 69,219,401 (GRCm39)	Y131H	probably benign	Het
Kcnu1	C	T	8: 26,422,362 (GRCm39)	P209L	probably benign	Het
Klk1b8	T	A	7: 43,448,094 (GRCm39)	C39*	probably null	Het
Mbtps1	A	G	8: 120,255,700 (GRCm39)	L519P	probably damaging	Het
Mgat4a	A	G	1: 37,495,673 (GRCm39)	I287T	probably damaging	Het
Mindy2	T	C	9: 70,512,480 (GRCm39)	E590G	possibly damaging	Het
Mllt11	G	T	3: 95,127,602 (GRCm39)	T56K	probably benign	Het
Myo5b	G	A	18: 74,875,249 (GRCm39)	R1551H	probably damaging	Het
Nmrk2	T	C	10: 81,036,796 (GRCm39)	T16A	possibly damaging	Het
Or2ab1	T	A	11: 58,488,831 (GRCm39)	F203Y	probably damaging	Het
Or7e170	G	T	9: 19,795,365 (GRCm39)	P79T	probably damaging	Het
Osbpl9	T	C	4: 109,013,899 (GRCm39)	D65G	probably damaging	Het
Phf2	T	A	13: 48,957,131 (GRCm39)	K1079*	probably null	Het
Plcb1	A	G	2: 135,212,486 (GRCm39)	S1026G	possibly damaging	Het
Pnrc2	A	T	4: 135,599,397 (GRCm39)	H117Q	probably benign	Het
Ppfia2	A	T	10: 106,749,455 (GRCm39)	I1114F	probably damaging	Het
Rpl12	G	A	2: 32,853,000 (GRCm39)	E72K	probably benign	Het
Sbf1	C	T	15: 89,177,679 (GRCm39)	R1642H	probably benign	Het
Sephs2	G	A	7: 126,873,118 (GRCm39)		probably benign	Het
Slc35c2	A	T	2: 165,122,617 (GRCm39)	L194H	probably damaging	Het
Slfn4	T	A	11: 83,079,938 (GRCm39)	Y150N	probably damaging	Het
Srbd1	T	C	17: 86,292,723 (GRCm39)	R949G	probably damaging	Het
Urah	T	A	7: 140,415,618 (GRCm39)	S28T	probably damaging	Het
Wdr62	A	G	7: 29,941,860 (GRCm39)	S649P	probably damaging	Het
Wnk1	C	A	6: 119,929,728 (GRCm39)	G1263V	probably damaging	Het
Zbtb4	C	A	11: 69,669,069 (GRCm39)	D114E	possibly damaging	Het

Other mutations in E2f2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01796:E2f2	APN	4	135,907,728 (GRCm39)	nonsense	probably null
IGL02078:E2f2	APN	4	135,920,323 (GRCm39)	missense	probably damaging	1.00
IGL02112:E2f2	APN	4	135,920,145 (GRCm39)	missense	probably benign	0.08
IGL02123:E2f2	APN	4	135,900,159 (GRCm39)	missense	probably benign	0.00
R0398:E2f2	UTSW	4	135,907,855 (GRCm39)	missense	probably damaging	1.00
R1594:E2f2	UTSW	4	135,914,141 (GRCm39)	missense	possibly damaging	0.85
R4729:E2f2	UTSW	4	135,911,760 (GRCm39)	missense	probably damaging	0.99
R5092:E2f2	UTSW	4	135,914,248 (GRCm39)	missense	probably benign	0.04
R5184:E2f2	UTSW	4	135,911,751 (GRCm39)	missense	possibly damaging	0.95
R5462:E2f2	UTSW	4	135,900,224 (GRCm39)	missense	probably benign	0.06
R5987:E2f2	UTSW	4	135,900,245 (GRCm39)	missense	probably benign	0.00
R7678:E2f2	UTSW	4	135,920,137 (GRCm39)	nonsense	probably null
R8247:E2f2	UTSW	4	135,900,126 (GRCm39)	missense	possibly damaging	0.76
R8261:E2f2	UTSW	4	135,911,791 (GRCm39)	synonymous	silent
R9147:E2f2	UTSW	4	135,908,595 (GRCm39)	critical splice acceptor site	probably null
R9148:E2f2	UTSW	4	135,908,595 (GRCm39)	critical splice acceptor site	probably null
R9606:E2f2	UTSW	4	135,911,743 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGACACTTCCTCACCAAG -3'
(R):5'- CGTGAGAATACACAAGAAACCTTG -3'

Sequencing Primer
(F):5'- TCCTCACCAAGTTCAGCCGG -3'
(R):5'- CCTTGGAAAAGGGAATTGTCTG -3'

Posted On

2018-02-28