Incidental Mutation 'R6237:Hspa1l'
ID505023
Institutional Source Beutler Lab
Gene Symbol Hspa1l
Ensembl Gene ENSMUSG00000007033
Gene Nameheat shock protein 1-like
Synonyms70kDa, Msh5, Hsc70t
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R6237 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34972703-34979285 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 34977452 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 156 (Q156*)
Ref Sequence ENSEMBL: ENSMUSP00000007248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000007266] [ENSMUST00000114011] [ENSMUST00000173004]
Predicted Effect probably null
Transcript: ENSMUST00000007248
AA Change: Q156*
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033
AA Change: Q156*

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000007266
SMART Domains Protein: ENSMUSP00000007266
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 41 108 8.91e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114011
SMART Domains Protein: ENSMUSP00000109644
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 5 72 8.91e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172890
Predicted Effect probably benign
Transcript: ENSMUST00000173004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174860
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah3 A C 7: 120,009,384 M1784R probably damaging Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
E2f2 A G 4: 136,178,485 E103G possibly damaging Het
Eef1akmt3 T A 10: 127,033,008 H199L possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Galnt5 G T 2: 58,035,249 W847C probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Ikzf3 C A 11: 98,467,053 R486L probably damaging Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sbf1 C T 15: 89,293,476 R1642H probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Wnk1 C A 6: 119,952,767 G1263V probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in Hspa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Hspa1l APN 17 34977465 missense probably damaging 1.00
IGL01548:Hspa1l APN 17 34978391 missense probably damaging 0.98
IGL01860:Hspa1l APN 17 34978811 missense probably benign 0.00
IGL01959:Hspa1l APN 17 34977135 missense probably damaging 1.00
IGL02661:Hspa1l APN 17 34977275 missense probably benign
R0355:Hspa1l UTSW 17 34977410 missense probably benign
R0850:Hspa1l UTSW 17 34977623 missense probably benign 0.01
R1675:Hspa1l UTSW 17 34977443 missense probably damaging 1.00
R2148:Hspa1l UTSW 17 34977390 missense probably damaging 0.98
R2169:Hspa1l UTSW 17 34977323 missense probably benign
R2418:Hspa1l UTSW 17 34977188 missense probably benign 0.05
R4323:Hspa1l UTSW 17 34977856 nonsense probably null
R4924:Hspa1l UTSW 17 34977856 nonsense probably null
R4926:Hspa1l UTSW 17 34978223 missense possibly damaging 0.92
R5186:Hspa1l UTSW 17 34978469 missense probably damaging 0.97
R5653:Hspa1l UTSW 17 34977420 missense probably damaging 1.00
R5790:Hspa1l UTSW 17 34977240 missense probably benign 0.08
R6086:Hspa1l UTSW 17 34978155 missense possibly damaging 0.77
R7229:Hspa1l UTSW 17 34977255 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGATCCTGTTGTGCAGTCAGATATG -3'
(R):5'- ATCGTCAGGATGGACACGTC -3'

Sequencing Primer
(F):5'- CAGTCAGATATGAAGCTTTGGCC -3'
(R):5'- GTCGAACGTGCCACCCC -3'
Posted On2018-02-28