Incidental Mutation 'R6238:Vmn2r107'
ID505081
Institutional Source Beutler Lab
Gene Symbol Vmn2r107
Ensembl Gene ENSMUSG00000056910
Gene Namevomeronasal 2, receptor 107
SynonymsV2r6
MMRRC Submission
Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20345425-20375772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20345587 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 55 (T55A)
Ref Sequence ENSEMBL: ENSMUSP00000048706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042090]
Predicted Effect probably benign
Transcript: ENSMUST00000042090
AA Change: T55A

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: T55A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 466 3.6e-40 PFAM
Pfam:NCD3G 509 562 5.1e-21 PFAM
Pfam:7tm_3 593 830 8e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Vmn2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Vmn2r107 APN 17 20375747 missense probably damaging 0.98
IGL01768:Vmn2r107 APN 17 20345606 missense probably benign 0.32
IGL02086:Vmn2r107 APN 17 20357800 missense probably benign 0.00
IGL02136:Vmn2r107 APN 17 20374906 missense probably benign 0.02
IGL02266:Vmn2r107 APN 17 20356777 missense probably damaging 1.00
IGL02285:Vmn2r107 APN 17 20375561 missense probably damaging 1.00
IGL02724:Vmn2r107 APN 17 20356744 missense possibly damaging 0.49
IGL02998:Vmn2r107 APN 17 20357755 missense probably damaging 0.99
IGL03089:Vmn2r107 APN 17 20375712 missense probably benign 0.05
IGL03284:Vmn2r107 APN 17 20356911 missense probably benign 0.07
IGL03307:Vmn2r107 APN 17 20356776 missense probably benign 0.09
IGL03399:Vmn2r107 APN 17 20357958 splice site probably benign
3-1:Vmn2r107 UTSW 17 20345504 missense probably benign
R0285:Vmn2r107 UTSW 17 20345611 missense probably benign 0.00
R0455:Vmn2r107 UTSW 17 20374823 splice site probably benign
R0497:Vmn2r107 UTSW 17 20375132 missense probably damaging 1.00
R0506:Vmn2r107 UTSW 17 20357759 missense probably benign
R0621:Vmn2r107 UTSW 17 20374990 missense probably benign 0.01
R0667:Vmn2r107 UTSW 17 20355654 missense possibly damaging 0.91
R1118:Vmn2r107 UTSW 17 20356598 missense probably benign 0.03
R1204:Vmn2r107 UTSW 17 20357769 missense probably benign
R1237:Vmn2r107 UTSW 17 20356685 nonsense probably null
R1485:Vmn2r107 UTSW 17 20374847 missense possibly damaging 0.95
R1783:Vmn2r107 UTSW 17 20356513 missense possibly damaging 0.51
R1873:Vmn2r107 UTSW 17 20345578 missense probably benign 0.10
R1974:Vmn2r107 UTSW 17 20355617 splice site probably null
R2009:Vmn2r107 UTSW 17 20375467 missense probably benign 0.01
R2029:Vmn2r107 UTSW 17 20375287 missense probably benign 0.01
R2164:Vmn2r107 UTSW 17 20375642 missense probably damaging 1.00
R2269:Vmn2r107 UTSW 17 20375555 missense possibly damaging 0.58
R3087:Vmn2r107 UTSW 17 20360345 missense probably benign 0.03
R3740:Vmn2r107 UTSW 17 20374889 missense probably benign 0.00
R3961:Vmn2r107 UTSW 17 20375455 missense probably damaging 1.00
R4031:Vmn2r107 UTSW 17 20375221 missense probably benign 0.00
R4270:Vmn2r107 UTSW 17 20355779 missense probably benign
R4963:Vmn2r107 UTSW 17 20375141 missense probably damaging 1.00
R5121:Vmn2r107 UTSW 17 20355753 missense probably benign 0.01
R5640:Vmn2r107 UTSW 17 20375164 missense probably damaging 1.00
R6007:Vmn2r107 UTSW 17 20375054 missense probably benign 0.19
R6298:Vmn2r107 UTSW 17 20355782 missense probably benign 0.00
R6467:Vmn2r107 UTSW 17 20375677 missense probably damaging 0.99
R6726:Vmn2r107 UTSW 17 20375375 missense probably damaging 0.96
R6782:Vmn2r107 UTSW 17 20356879 missense probably damaging 1.00
X0022:Vmn2r107 UTSW 17 20356968 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCAATGTGCTAATAGGATGTTCTC -3'
(R):5'- TTTCCTCCTGAGTGTGGAATATAATCC -3'

Sequencing Primer
(F):5'- GGATGTTCTCCTGGATTTTTATCTTC -3'
(R):5'- ATGGCTACACCCATTACG -3'
Posted On2018-02-28