Incidental Mutation 'R6239:Casz1'
ID505109
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 044363-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R6239 (G1)
Quality Score141.008
Status Validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148938277 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 600 (Q600R)
Ref Sequence ENSEMBL: ENSMUSP00000092035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000139806]
Predicted Effect probably damaging
Transcript: ENSMUST00000094464
AA Change: Q600R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977
AA Change: Q600R

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122222
AA Change: Q600R

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: Q600R

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139806
AA Change: Q314R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120307
Gene: ENSMUSG00000028977
AA Change: Q314R

DomainStartEndE-ValueType
low complexity region 117 134 N/A INTRINSIC
ZnF_C2H2 203 228 5.34e0 SMART
ZnF_C2H2 264 288 8.09e-1 SMART
ZnF_C2H2 323 347 9.3e-1 SMART
low complexity region 357 372 N/A INTRINSIC
ZnF_C2H2 381 405 1.1e-2 SMART
low complexity region 412 425 N/A INTRINSIC
low complexity region 442 480 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 524 548 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T A 1: 78,696,465 S373T probably benign Het
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Cyp2t4 A T 7: 27,157,475 Q280L possibly damaging Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Flg2 A T 3: 93,201,272 E202D probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pald1 T C 10: 61,321,131 S847G possibly damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Slc13a3 T C 2: 165,406,697 T554A unknown Het
Snw1 A T 12: 87,464,628 N84K probably damaging Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trappc11 G A 8: 47,529,494 T70M possibly damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCTGAATAGAACCCCATGG -3'
(R):5'- TCTCGTGGGAAGACTGAAGG -3'

Sequencing Primer
(F):5'- CAGGAGGACCAGACTTGCAC -3'
(R):5'- GCAGGGCCATTAAGCAGC -3'
Posted On2018-02-28