Incidental Mutation 'R6239:Pald1'
ID505128
Institutional Source Beutler Lab
Gene Symbol Pald1
Ensembl Gene ENSMUSG00000020092
Gene Namephosphatase domain containing, paladin 1
Synonymspaladin, X99384
MMRRC Submission 044363-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R6239 (G1)
Quality Score220.009
Status Validated
Chromosome10
Chromosomal Location61319656-61383530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61321131 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 847 (S847G)
Ref Sequence ENSEMBL: ENSMUSP00000020289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020289]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020289
AA Change: S847G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020289
Gene: ENSMUSG00000020092
AA Change: S847G

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
PTPlike_phytase 164 333 4.33e-53 SMART
low complexity region 428 441 N/A INTRINSIC
PTPlike_phytase 548 682 5.37e-49 SMART
low complexity region 757 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219240
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T A 1: 78,696,465 S373T probably benign Het
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Casz1 A G 4: 148,938,277 Q600R probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Cyp2t4 A T 7: 27,157,475 Q280L possibly damaging Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Flg2 A T 3: 93,201,272 E202D probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Slc13a3 T C 2: 165,406,697 T554A unknown Het
Snw1 A T 12: 87,464,628 N84K probably damaging Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trappc11 G A 8: 47,529,494 T70M possibly damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Pald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Pald1 APN 10 61347141 splice site probably benign
IGL03068:Pald1 APN 10 61321184 missense possibly damaging 0.94
IGL03106:Pald1 APN 10 61347105 missense probably benign 0.41
R0331:Pald1 UTSW 10 61340929 critical splice donor site probably null
R0497:Pald1 UTSW 10 61341315 missense probably damaging 0.99
R1181:Pald1 UTSW 10 61347587 splice site probably benign
R1437:Pald1 UTSW 10 61341285 missense possibly damaging 0.63
R1466:Pald1 UTSW 10 61348525 splice site probably benign
R1827:Pald1 UTSW 10 61355922 small deletion probably benign
R2129:Pald1 UTSW 10 61348306 critical splice donor site probably null
R2184:Pald1 UTSW 10 61347136 missense possibly damaging 0.46
R2260:Pald1 UTSW 10 61352971 missense probably damaging 1.00
R3051:Pald1 UTSW 10 61346763 nonsense probably null
R3690:Pald1 UTSW 10 61355808 splice site probably null
R3713:Pald1 UTSW 10 61342365 missense possibly damaging 0.67
R3876:Pald1 UTSW 10 61347487 missense probably damaging 0.97
R4261:Pald1 UTSW 10 61343692 missense probably damaging 1.00
R4600:Pald1 UTSW 10 61348616 missense probably benign 0.00
R4603:Pald1 UTSW 10 61348616 missense probably benign 0.00
R5069:Pald1 UTSW 10 61341246 missense possibly damaging 0.50
R5354:Pald1 UTSW 10 61348661 missense probably damaging 1.00
R5590:Pald1 UTSW 10 61343710 missense probably damaging 1.00
R5705:Pald1 UTSW 10 61323297 missense possibly damaging 0.90
R5780:Pald1 UTSW 10 61339218 missense probably damaging 1.00
R6380:Pald1 UTSW 10 61350935 missense possibly damaging 0.86
R6812:Pald1 UTSW 10 61342922 missense possibly damaging 0.53
R6891:Pald1 UTSW 10 61348532 critical splice donor site probably null
R6949:Pald1 UTSW 10 61321217 missense probably benign 0.23
R7038:Pald1 UTSW 10 61339299 missense probably benign
R7051:Pald1 UTSW 10 61323346 missense probably benign 0.26
R7188:Pald1 UTSW 10 61347066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACAGAAAATGGTGGTGCC -3'
(R):5'- GACAGTAGGCCTGATGCTAC -3'

Sequencing Primer
(F):5'- TGGTGGTGCCATCTTACAC -3'
(R):5'- GTAGGCCTGATGCTACCTCCAC -3'
Posted On2018-02-28