Incidental Mutation 'R6240:Zfp628'
ID505169
Institutional Source Beutler Lab
Gene Symbol Zfp628
Ensembl Gene ENSMUSG00000074406
Gene Namezinc finger protein 628
SynonymsZec
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R6240 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4915217-4922002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4919849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 357 (T357A)
Ref Sequence ENSEMBL: ENSMUSP00000112058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047309] [ENSMUST00000116354] [ENSMUST00000207506] [ENSMUST00000207527] [ENSMUST00000207687] [ENSMUST00000208754]
Predicted Effect probably benign
Transcript: ENSMUST00000047309
SMART Domains Protein: ENSMUSP00000045354
Gene: ENSMUSG00000035285

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Pfam:Acetyltransf_1 101 186 4.1e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116354
AA Change: T357A

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112058
Gene: ENSMUSG00000074406
AA Change: T357A

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
ZnF_C2H2 34 56 1.04e-3 SMART
ZnF_C2H2 62 84 2.4e-3 SMART
ZnF_C2H2 90 112 2.09e-3 SMART
ZnF_C2H2 118 140 1.56e-2 SMART
ZnF_C2H2 146 168 3.69e-4 SMART
ZnF_C2H2 174 196 7.49e-5 SMART
ZnF_C2H2 202 224 1.69e-3 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 255 275 N/A INTRINSIC
ZnF_C2H2 289 309 1.38e2 SMART
low complexity region 334 344 N/A INTRINSIC
ZnF_C2H2 346 368 1.76e-1 SMART
ZnF_C2H2 376 398 9.3e-1 SMART
low complexity region 422 440 N/A INTRINSIC
ZnF_C2H2 446 468 2.75e-3 SMART
ZnF_C2H2 474 496 1.69e-3 SMART
ZnF_C2H2 502 524 1.45e-2 SMART
ZnF_C2H2 530 552 1.03e-2 SMART
ZnF_C2H2 558 580 3.44e-4 SMART
ZnF_C2H2 586 608 2.61e-4 SMART
ZnF_C2H2 614 636 7.9e-4 SMART
low complexity region 685 703 N/A INTRINSIC
low complexity region 716 756 N/A INTRINSIC
low complexity region 770 792 N/A INTRINSIC
low complexity region 981 1000 N/A INTRINSIC
low complexity region 1001 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207506
Predicted Effect probably benign
Transcript: ENSMUST00000207527
Predicted Effect probably benign
Transcript: ENSMUST00000207687
Predicted Effect probably benign
Transcript: ENSMUST00000208754
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), which bind nucleic acids, perform many key functions, the most important of which is regulating transcription. See ZNF91 (MIM 603971) for general information on ZNFs.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Zfp628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp628 APN 7 4920806 missense probably damaging 1.00
R0107:Zfp628 UTSW 7 4920168 missense probably damaging 1.00
R0110:Zfp628 UTSW 7 4919733 missense probably benign
R0450:Zfp628 UTSW 7 4919733 missense probably benign
R0469:Zfp628 UTSW 7 4919733 missense probably benign
R0480:Zfp628 UTSW 7 4921616 missense probably benign 0.00
R0518:Zfp628 UTSW 7 4919940 missense probably damaging 0.97
R0521:Zfp628 UTSW 7 4919940 missense probably damaging 0.97
R1081:Zfp628 UTSW 7 4920183 missense probably damaging 1.00
R1846:Zfp628 UTSW 7 4920867 missense possibly damaging 0.52
R1938:Zfp628 UTSW 7 4920768 missense probably benign 0.00
R1997:Zfp628 UTSW 7 4918832 missense probably damaging 0.98
R2221:Zfp628 UTSW 7 4920831 missense probably benign 0.00
R2364:Zfp628 UTSW 7 4920687 missense probably damaging 1.00
R3077:Zfp628 UTSW 7 4921200 missense possibly damaging 0.88
R3964:Zfp628 UTSW 7 4921745 missense probably benign 0.00
R3966:Zfp628 UTSW 7 4921745 missense probably benign 0.00
R6058:Zfp628 UTSW 7 4920918 missense probably damaging 1.00
R6516:Zfp628 UTSW 7 4920202 nonsense probably null
R6962:Zfp628 UTSW 7 4919550 missense probably benign 0.03
R7180:Zfp628 UTSW 7 4921064 missense probably benign 0.18
R7347:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
R7348:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
R7349:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
X0022:Zfp628 UTSW 7 4919409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTGGAGCTAGTGTACCGC -3'
(R):5'- CACTCGGCACATTTGTAGGG -3'

Sequencing Primer
(F):5'- AGCTAGTGTACCGCTGCGATG -3'
(R):5'- ACATTTGTAGGGCCGCTC -3'
Posted On2018-02-28