Incidental Mutation 'R6240:Clmp'
ID505180
Institutional Source Beutler Lab
Gene Symbol Clmp
Ensembl Gene ENSMUSG00000032024
Gene NameCXADR-like membrane protein
Synonyms
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6240 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location40685962-40785319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40782411 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 308 (N308S)
Ref Sequence ENSEMBL: ENSMUSP00000034522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034522]
Predicted Effect probably damaging
Transcript: ENSMUST00000034522
AA Change: N308S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034522
Gene: ENSMUSG00000032024
AA Change: N308S

DomainStartEndE-ValueType
IG 19 128 3.46e-7 SMART
IGc2 143 214 1.29e-6 SMART
transmembrane domain 233 255 N/A INTRINSIC
low complexity region 287 313 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149386
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. Expression of this gene in white adipose tissue is implicated in adipocyte maturation and development of obesity. This gene is also essential for normal intestinal development and mutations in the gene are associated with congenital short bowel syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit reduced viability, bilateral hydronephrosis, increased mean systolic blood pressure, and exhibit several blood chemistry and neurological anomalies. Null mice are samller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Clmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Clmp APN 9 40782610 makesense probably null
IGL01783:Clmp APN 9 40782407 missense possibly damaging 0.91
IGL02565:Clmp APN 9 40772415 missense probably damaging 1.00
IGL02953:Clmp APN 9 40774387 missense probably damaging 1.00
IGL02976:Clmp APN 9 40781224 missense possibly damaging 0.92
IGL03357:Clmp APN 9 40686327 utr 5 prime probably benign
IGL03383:Clmp APN 9 40774441 missense probably damaging 1.00
R0530:Clmp UTSW 9 40761006 missense probably benign 0.00
R0539:Clmp UTSW 9 40782486 missense probably benign 0.00
R1453:Clmp UTSW 9 40782441 missense probably damaging 0.98
R1623:Clmp UTSW 9 40782560 missense probably benign
R2899:Clmp UTSW 9 40782392 missense probably damaging 1.00
R4175:Clmp UTSW 9 40771136 missense probably benign 0.04
R5570:Clmp UTSW 9 40772530 critical splice donor site probably null
R6048:Clmp UTSW 9 40771109 missense probably damaging 1.00
R6551:Clmp UTSW 9 40771277 missense probably benign
R7216:Clmp UTSW 9 40760909 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACTTTAACGAGCGTCAACCC -3'
(R):5'- CGCAAGTCAAGTCCACTCTAAGTC -3'

Sequencing Primer
(F):5'- CAGCCCCGGCAGTACTAAAG -3'
(R):5'- GTCCACTCTAAGTCAGACAGTTTGG -3'
Posted On2018-02-28