Incidental Mutation 'R6240:Psmd3'
ID505189
Institutional Source Beutler Lab
Gene Symbol Psmd3
Ensembl Gene ENSMUSG00000017221
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 3
SynonymsPsd3, AntP91a, Tstap91a
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R6240 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98682554-98695979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98693653 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 387 (T387A)
Ref Sequence ENSEMBL: ENSMUSP00000017365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017365]
Predicted Effect probably damaging
Transcript: ENSMUST00000017365
AA Change: T387A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017365
Gene: ENSMUSG00000017221
AA Change: T387A

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
PAM 217 389 1.07e-68 SMART
PINT 389 479 3.26e-27 SMART
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123676
AA Change: T195A
SMART Domains Protein: ENSMUSP00000116968
Gene: ENSMUSG00000017221
AA Change: T195A

DomainStartEndE-ValueType
PAM 2 198 2.1e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152102
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Psmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Psmd3 APN 11 98685568 missense probably benign 0.06
IGL01353:Psmd3 APN 11 98690600 missense probably benign 0.05
R1368:Psmd3 UTSW 11 98682920 missense probably damaging 1.00
R1563:Psmd3 UTSW 11 98694225 missense probably damaging 1.00
R2258:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R2259:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R3606:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R3607:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R4616:Psmd3 UTSW 11 98682926 missense probably benign 0.00
R4833:Psmd3 UTSW 11 98687760 missense probably damaging 1.00
R5033:Psmd3 UTSW 11 98682824 missense probably damaging 1.00
R5585:Psmd3 UTSW 11 98682881 missense possibly damaging 0.45
R5687:Psmd3 UTSW 11 98693669 missense probably damaging 1.00
R5929:Psmd3 UTSW 11 98695596 missense probably damaging 1.00
R6028:Psmd3 UTSW 11 98685665 missense probably damaging 0.99
R6449:Psmd3 UTSW 11 98685640 missense probably benign
R6956:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7009:Psmd3 UTSW 11 98682766 missense probably benign 0.04
R7051:Psmd3 UTSW 11 98682833 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTCACCCAAGGTAAGGCTG -3'
(R):5'- AACTCTGCATCTTCTGGGC -3'

Sequencing Primer
(F):5'- AAGGTAAGGCTGCTCCCACAG -3'
(R):5'- GACCCAAATCGTACCTGT -3'
Posted On2018-02-28