Incidental Mutation 'R6240:Gm8765'
ID505192
Institutional Source Beutler Lab
Gene Symbol Gm8765
Ensembl Gene ENSMUSG00000094918
Gene Namepredicted gene 8765
Synonyms
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6240 (G1)
Quality Score81.0075
Status Not validated
Chromosome13
Chromosomal Location50698312-50703435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50701417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 364 (D364N)
Ref Sequence ENSEMBL: ENSMUSP00000097118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099518]
Predicted Effect probably damaging
Transcript: ENSMUST00000099518
AA Change: D364N

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097118
Gene: ENSMUSG00000094918
AA Change: D364N

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
Pfam:FAM75 95 418 1.1e-15 PFAM
SCOP:d1i5pa1 811 874 9e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Gm8765
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gm8765 APN 13 50700378 missense probably benign 0.18
IGL02452:Gm8765 APN 13 50703077 missense probably damaging 0.99
IGL02610:Gm8765 APN 13 50701712 missense possibly damaging 0.91
IGL03171:Gm8765 APN 13 50702352 missense probably benign 0.23
IGL03369:Gm8765 APN 13 50703164 missense possibly damaging 0.74
PIT4382001:Gm8765 UTSW 13 50700971 missense probably damaging 0.99
R0346:Gm8765 UTSW 13 50703310 missense probably benign 0.12
R1015:Gm8765 UTSW 13 50701628 missense possibly damaging 0.92
R1054:Gm8765 UTSW 13 50702396 missense probably benign 0.01
R1102:Gm8765 UTSW 13 50703082 missense probably benign 0.00
R1519:Gm8765 UTSW 13 50700407 critical splice donor site probably null
R1628:Gm8765 UTSW 13 50702288 missense probably benign 0.25
R1754:Gm8765 UTSW 13 50701087 missense probably damaging 0.98
R4212:Gm8765 UTSW 13 50700352 missense possibly damaging 0.94
R4672:Gm8765 UTSW 13 50703172 missense probably benign
R4780:Gm8765 UTSW 13 50701080 missense probably damaging 0.97
R4794:Gm8765 UTSW 13 50703239 missense probably benign 0.07
R5171:Gm8765 UTSW 13 50700378 missense possibly damaging 0.85
R6366:Gm8765 UTSW 13 50701936 missense probably benign 0.01
R6421:Gm8765 UTSW 13 50701951 missense probably benign 0.35
R6644:Gm8765 UTSW 13 50702035 missense possibly damaging 0.54
R6678:Gm8765 UTSW 13 50701910 missense probably benign 0.14
R6788:Gm8765 UTSW 13 50703095 missense probably damaging 0.99
R7030:Gm8765 UTSW 13 50702983 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGGAACCCCATTCAGATTCCTC -3'
(R):5'- TGGACACTCTGTGAAATTTGATGC -3'

Sequencing Primer
(F):5'- ATTCAGATTCCTCCCCTACAGG -3'
(R):5'- AAATTTGATGCTGTCTTTGCCTCAG -3'
Posted On2018-02-28