Incidental Mutation 'R6240:Adamts12'
ID505202
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
MMRRC Submission 044364-MU
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R6240 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11285958 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 751 (D751V)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: D751V

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: D751V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AATTCTGTGGCTGGCTCGTC -3'
(R):5'- TATTGAGCACACTGGCCAC -3'

Sequencing Primer
(F):5'- CCACGGGCACTGAAGGATG -3'
(R):5'- ACCAGCCCGTTCCCTTC -3'
Posted On2018-02-28