Incidental Mutation 'R6240:9930021J03Rik'
ID505213
Institutional Source Beutler Lab
Gene Symbol 9930021J03Rik
Ensembl Gene ENSMUSG00000046138
Gene NameRIKEN cDNA 9930021J03 gene
SynonymsGm9832
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6240 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29714402-29805989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29717240 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1618 (S1618T)
Ref Sequence ENSEMBL: ENSMUSP00000135473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177155]
Predicted Effect unknown
Transcript: ENSMUST00000175726
AA Change: S1562T
Predicted Effect unknown
Transcript: ENSMUST00000175764
AA Change: S917T
SMART Domains Protein: ENSMUSP00000135031
Gene: ENSMUSG00000046138
AA Change: S917T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 379 393 N/A INTRINSIC
internal_repeat_1 397 526 2.65e-5 PROSPERO
low complexity region 528 537 N/A INTRINSIC
low complexity region 619 648 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 835 857 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 965 978 N/A INTRINSIC
internal_repeat_1 999 1143 2.65e-5 PROSPERO
low complexity region 1220 1226 N/A INTRINSIC
low complexity region 1246 1260 N/A INTRINSIC
low complexity region 1286 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176773
Predicted Effect probably benign
Transcript: ENSMUST00000177155
AA Change: S1618T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135473
Gene: ENSMUSG00000046138
AA Change: S1618T

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 205 219 N/A INTRINSIC
low complexity region 280 298 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
coiled coil region 606 638 N/A INTRINSIC
low complexity region 655 689 N/A INTRINSIC
coiled coil region 697 729 N/A INTRINSIC
low complexity region 1079 1093 N/A INTRINSIC
internal_repeat_1 1097 1226 1.32e-7 PROSPERO
low complexity region 1228 1237 N/A INTRINSIC
low complexity region 1319 1348 N/A INTRINSIC
low complexity region 1401 1416 N/A INTRINSIC
low complexity region 1535 1557 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1665 1678 N/A INTRINSIC
internal_repeat_1 1699 1843 1.32e-7 PROSPERO
low complexity region 1920 1926 N/A INTRINSIC
low complexity region 1946 1960 N/A INTRINSIC
low complexity region 1986 2004 N/A INTRINSIC
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in 9930021J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:9930021J03Rik APN 19 29754020 missense probably benign 0.33
IGL01535:9930021J03Rik APN 19 29753812 missense possibly damaging 0.53
IGL02019:9930021J03Rik APN 19 29717063 missense probably benign 0.28
IGL02034:9930021J03Rik APN 19 29716859 missense possibly damaging 0.73
IGL03114:9930021J03Rik APN 19 29717132 missense probably benign 0.18
IGL03382:9930021J03Rik APN 19 29717276 missense probably damaging 1.00
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0142:9930021J03Rik UTSW 19 29718254 missense possibly damaging 0.93
R0178:9930021J03Rik UTSW 19 29754788 missense probably damaging 1.00
R0453:9930021J03Rik UTSW 19 29753668 missense probably damaging 1.00
R0730:9930021J03Rik UTSW 19 29717981 missense probably benign 0.00
R0735:9930021J03Rik UTSW 19 29717638 missense possibly damaging 0.92
R0891:9930021J03Rik UTSW 19 29717653 missense probably damaging 1.00
R0894:9930021J03Rik UTSW 19 29720574 splice site probably benign
R1289:9930021J03Rik UTSW 19 29723452 missense probably benign 0.07
R1368:9930021J03Rik UTSW 19 29716396 missense probably damaging 0.97
R1387:9930021J03Rik UTSW 19 29723453 missense probably benign 0.15
R1483:9930021J03Rik UTSW 19 29719345 missense possibly damaging 0.93
R1526:9930021J03Rik UTSW 19 29735145 missense probably damaging 1.00
R1612:9930021J03Rik UTSW 19 29717845 missense possibly damaging 0.86
R1721:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1764:9930021J03Rik UTSW 19 29719160 missense possibly damaging 0.53
R1822:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1824:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1859:9930021J03Rik UTSW 19 29754923 missense possibly damaging 0.53
R1868:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1880:9930021J03Rik UTSW 19 29718123 missense probably benign 0.06
R1898:9930021J03Rik UTSW 19 29735132 missense possibly damaging 0.74
R1936:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1939:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1969:9930021J03Rik UTSW 19 29716675 missense possibly damaging 0.95
R2153:9930021J03Rik UTSW 19 29716829 missense probably benign 0.01
R2366:9930021J03Rik UTSW 19 29753635 missense probably damaging 0.99
R2379:9930021J03Rik UTSW 19 29718875 missense probably benign 0.01
R3107:9930021J03Rik UTSW 19 29723447 missense probably damaging 1.00
R4012:9930021J03Rik UTSW 19 29743590 missense probably damaging 1.00
R4222:9930021J03Rik UTSW 19 29718749 missense probably benign 0.18
R4328:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4329:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4387:9930021J03Rik UTSW 19 29805315 unclassified probably benign
R4688:9930021J03Rik UTSW 19 29717101 missense probably benign 0.33
R4796:9930021J03Rik UTSW 19 29753618 missense probably benign 0.33
R4820:9930021J03Rik UTSW 19 29718409 missense possibly damaging 0.53
R4832:9930021J03Rik UTSW 19 29717216 missense possibly damaging 0.53
R5056:9930021J03Rik UTSW 19 29717359 missense probably benign
R5150:9930021J03Rik UTSW 19 29805550 missense probably damaging 0.96
R5224:9930021J03Rik UTSW 19 29719050 missense possibly damaging 0.73
R5306:9930021J03Rik UTSW 19 29729830 intron probably benign
R5460:9930021J03Rik UTSW 19 29754850 missense probably damaging 0.98
R5477:9930021J03Rik UTSW 19 29754118 missense probably benign 0.33
R5531:9930021J03Rik UTSW 19 29753672 missense possibly damaging 0.73
R5559:9930021J03Rik UTSW 19 29716963 missense possibly damaging 0.91
R5647:9930021J03Rik UTSW 19 29753810 missense possibly damaging 0.73
R5886:9930021J03Rik UTSW 19 29719277 missense probably benign 0.03
R6029:9930021J03Rik UTSW 19 29754967 unclassified probably benign
R6331:9930021J03Rik UTSW 19 29717747 missense probably benign 0.33
R6456:9930021J03Rik UTSW 19 29716514 missense possibly damaging 0.93
R6584:9930021J03Rik UTSW 19 29718728 missense possibly damaging 0.53
R6661:9930021J03Rik UTSW 19 29723464 missense possibly damaging 0.53
R6991:9930021J03Rik UTSW 19 29719108 missense possibly damaging 0.86
R7059:9930021J03Rik UTSW 19 29719545 missense probably benign 0.33
R7128:9930021J03Rik UTSW 19 29716481 missense possibly damaging 0.53
R7211:9930021J03Rik UTSW 19 29786312 missense
X0027:9930021J03Rik UTSW 19 29735199 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTACAGGTGTAGGCAAGGC -3'
(R):5'- AGTAAGAGCTGCATCTCCCC -3'

Sequencing Primer
(F):5'- GGCAACAGTCACAGGAATCTGC -3'
(R):5'- GCTCCAGCAAGCTCAAATATTGTG -3'
Posted On2018-02-28