Incidental Mutation 'R6241:Pla2r1'
ID505216
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6241 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 60502199 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably null
Transcript: ENSMUST00000112525
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128208
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gm5346 T A 8: 43,626,096 I364L probably benign Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Ints9 C T 14: 64,980,210 T62I possibly damaging Het
Itga1 G T 13: 114,960,137 probably null Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Nudt9 T C 5: 104,054,285 S71P probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Setd3 C T 12: 108,157,855 E192K probably benign Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Tmx4 C T 2: 134,639,505 probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AGTCTCGGTATCAGTGCCAC -3'
(R):5'- AGACCTATATTGAGCAAACCTGG -3'

Sequencing Primer
(F):5'- TCGGTATCAGTGCCACAAAACTG -3'
(R):5'- TATTGAGCAAACCTGGATATTAGGG -3'
Posted On2018-02-28