Incidental Mutation 'R6241:Nudt9'
ID505228
Institutional Source Beutler Lab
Gene Symbol Nudt9
Ensembl Gene ENSMUSG00000029310
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 9
Synonyms1190002C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6241 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104046306-104065379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104054285 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 71 (S71P)
Ref Sequence ENSEMBL: ENSMUSP00000115170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031250] [ENSMUST00000128511] [ENSMUST00000134313] [ENSMUST00000148261] [ENSMUST00000150226]
Predicted Effect probably benign
Transcript: ENSMUST00000031250
AA Change: S121P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000031250
Gene: ENSMUSG00000029310
AA Change: S121P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Pfam:NUDIX 189 334 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128511
AA Change: S71P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119820
Gene: ENSMUSG00000029310
AA Change: S71P

DomainStartEndE-ValueType
PDB:1QVJ|A 9 158 1e-89 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134313
AA Change: S71P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117181
Gene: ENSMUSG00000029310
AA Change: S71P

DomainStartEndE-ValueType
PDB:1QVJ|A 9 152 2e-84 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142018
Predicted Effect probably damaging
Transcript: ENSMUST00000148261
AA Change: S71P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115170
Gene: ENSMUSG00000029310
AA Change: S71P

DomainStartEndE-ValueType
PDB:1QVJ|A 9 110 2e-68 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150226
AA Change: S71P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114631
Gene: ENSMUSG00000029310
AA Change: S71P

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
Pfam:NUDIX 131 207 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gm5346 T A 8: 43,626,096 I364L probably benign Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Ints9 C T 14: 64,980,210 T62I possibly damaging Het
Itga1 G T 13: 114,960,137 probably null Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Pla2r1 G T 2: 60,502,199 probably null Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Setd3 C T 12: 108,157,855 E192K probably benign Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Tmx4 C T 2: 134,639,505 probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Nudt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Nudt9 APN 5 104061762 unclassified probably benign
IGL01398:Nudt9 APN 5 104065113 makesense probably null
IGL01910:Nudt9 APN 5 104054309 missense probably damaging 0.96
IGL02441:Nudt9 APN 5 104065019 missense probably benign 0.01
IGL03207:Nudt9 APN 5 104058226 splice site probably benign
steady UTSW 5 104058111 missense probably damaging 1.00
streak UTSW 5 104050621 start codon destroyed possibly damaging 0.89
struck UTSW 5 104065038 nonsense probably null
R0136:Nudt9 UTSW 5 104047106 missense probably benign
R0227:Nudt9 UTSW 5 104061675 missense possibly damaging 0.90
R0652:Nudt9 UTSW 5 104050601 missense possibly damaging 0.48
R0755:Nudt9 UTSW 5 104065054 missense probably damaging 0.98
R1156:Nudt9 UTSW 5 104050730 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1962:Nudt9 UTSW 5 104065105 missense probably benign
R2697:Nudt9 UTSW 5 104064993 missense probably damaging 1.00
R2916:Nudt9 UTSW 5 104055558 missense probably damaging 1.00
R3780:Nudt9 UTSW 5 104047106 missense probably benign
R3972:Nudt9 UTSW 5 104047125 missense probably benign 0.00
R4354:Nudt9 UTSW 5 104058111 missense probably damaging 1.00
R5325:Nudt9 UTSW 5 104050621 start codon destroyed possibly damaging 0.89
R5652:Nudt9 UTSW 5 104059780 missense probably benign 0.19
R6087:Nudt9 UTSW 5 104050813 missense probably benign 0.00
R6240:Nudt9 UTSW 5 104047089 missense probably benign 0.31
R6280:Nudt9 UTSW 5 104065069 missense probably benign
R6719:Nudt9 UTSW 5 104061696 missense probably damaging 1.00
R6865:Nudt9 UTSW 5 104059679 missense probably damaging 1.00
R7225:Nudt9 UTSW 5 104065100 missense probably benign
X0063:Nudt9 UTSW 5 104050694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCCAACCTCCTTACAAGAAG -3'
(R):5'- TAAACTCTGTACCTCGTCTGGC -3'

Sequencing Primer
(F):5'- ACAGCTCATAACACTACATCCTTTTC -3'
(R):5'- GGCTTTACGGTTATACTCTGAACAC -3'
Posted On2018-02-28