Incidental Mutation 'R6241:Setd3'
ID505251
Institutional Source Beutler Lab
Gene Symbol Setd3
Ensembl Gene ENSMUSG00000056770
Gene NameSET domain containing 3
Synonyms2610305M23Rik, 2610102I01Rik, D12Ertd771e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6241 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location108106431-108179314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108157855 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 192 (E192K)
Ref Sequence ENSEMBL: ENSMUSP00000105505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071095] [ENSMUST00000109879] [ENSMUST00000125916] [ENSMUST00000132682] [ENSMUST00000147466]
Predicted Effect probably benign
Transcript: ENSMUST00000071095
AA Change: E192K

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066413
Gene: ENSMUSG00000056770
AA Change: E192K

DomainStartEndE-ValueType
Pfam:SET 105 314 2.1e-12 PFAM
Pfam:Rubis-subs-bind 345 475 3.7e-31 PFAM
low complexity region 565 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109879
AA Change: E192K

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105505
Gene: ENSMUSG00000056770
AA Change: E192K

DomainStartEndE-ValueType
Pfam:SET 105 287 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125916
SMART Domains Protein: ENSMUSP00000122520
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 9 155 1e-100 PDB
Blast:SET 101 155 5e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132682
SMART Domains Protein: ENSMUSP00000123159
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147466
SMART Domains Protein: ENSMUSP00000121406
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169951
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gm5346 T A 8: 43,626,096 I364L probably benign Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Ints9 C T 14: 64,980,210 T62I possibly damaging Het
Itga1 G T 13: 114,960,137 probably null Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Nudt9 T C 5: 104,054,285 S71P probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Pla2r1 G T 2: 60,502,199 probably null Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Tmx4 C T 2: 134,639,505 probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Setd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Setd3 APN 12 108160237 missense probably damaging 1.00
IGL01365:Setd3 APN 12 108157906 missense probably damaging 1.00
IGL02031:Setd3 APN 12 108163030 missense probably damaging 1.00
IGL02826:Setd3 APN 12 108112124 unclassified probably benign
IGL02878:Setd3 APN 12 108108555 critical splice donor site probably null
IGL03039:Setd3 APN 12 108162970 splice site probably null
R0332:Setd3 UTSW 12 108107579 missense probably benign
R1644:Setd3 UTSW 12 108113344 missense possibly damaging 0.88
R1776:Setd3 UTSW 12 108165161 missense probably damaging 1.00
R2018:Setd3 UTSW 12 108118254 missense probably damaging 1.00
R2025:Setd3 UTSW 12 108160267 missense probably damaging 1.00
R2041:Setd3 UTSW 12 108113392 missense possibly damaging 0.84
R2058:Setd3 UTSW 12 108107341 missense probably benign 0.03
R2206:Setd3 UTSW 12 108107285 missense probably benign 0.11
R2207:Setd3 UTSW 12 108107285 missense probably benign 0.11
R3973:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3976:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3978:Setd3 UTSW 12 108157942 missense possibly damaging 0.63
R4684:Setd3 UTSW 12 108108690 missense probably benign 0.05
R4965:Setd3 UTSW 12 108113371 missense probably benign 0.29
R5691:Setd3 UTSW 12 108160285 missense probably benign 0.19
R5990:Setd3 UTSW 12 108160335 missense probably benign
R6198:Setd3 UTSW 12 108165168 missense possibly damaging 0.66
R6428:Setd3 UTSW 12 108113338 missense probably damaging 0.99
X0052:Setd3 UTSW 12 108107665 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTGATCCTGGATGCTGATGAAG -3'
(R):5'- CCCTGCTAACTTCTGGGTTG -3'

Sequencing Primer
(F):5'- GTGCCTGAGTACCCTCAAG -3'
(R):5'- GATTTAGGGCCCCTGTATTCTCAAG -3'
Posted On2018-02-28