Incidental Mutation 'R6242:Fancm'
ID505317
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R6242 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65116442 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1460 (Q1460L)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000221838] [ENSMUST00000222540]
Predicted Effect probably benign
Transcript: ENSMUST00000058889
AA Change: Q1460L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: Q1460L

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222086
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 99% (75/76)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,763,915 E148K probably benign Het
1700016K19Rik T C 11: 76,000,155 S32P probably damaging Het
4933425L06Rik T A 13: 105,109,540 V203E probably benign Het
Adcy6 G T 15: 98,604,015 C239* probably null Het
Akr1c6 A G 13: 4,436,362 Q56R probably benign Het
Apaf1 T A 10: 91,062,163 D244V probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef11 C A 3: 87,728,078 A898E probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atf6 T A 1: 170,793,976 Q492L possibly damaging Het
Atrnl1 G T 19: 57,642,478 V226F probably benign Het
Cntnap1 A T 11: 101,182,538 Y615F probably damaging Het
Crybg3 T C 16: 59,555,690 T1734A probably benign Het
Ctdp1 A C 18: 80,459,212 V161G probably damaging Het
Cyp4a30b T A 4: 115,454,390 V85E possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha6 A T 16: 59,682,662 W961R probably damaging Het
Fam114a1 A G 5: 65,031,352 E475G probably damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fgf14 T C 14: 124,676,528 K64E probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Garem1 C G 18: 21,129,172 V862L possibly damaging Het
Grin3b G A 10: 79,976,179 G814R probably damaging Het
Hacd4 A G 4: 88,414,287 S226P probably benign Het
Htt A G 5: 34,846,012 Y1277C probably damaging Het
Igkv1-131 T A 6: 67,766,078 D107V probably damaging Het
Iqcc T C 4: 129,616,846 D292G probably damaging Het
Krtap13 C T 16: 88,751,496 V35I probably damaging Het
Lrrc59 G T 11: 94,634,983 L132F possibly damaging Het
Mcub T C 3: 129,915,795 S290G probably benign Het
Mettl4 A G 17: 94,735,374 W345R probably damaging Het
Msgn1 G A 12: 11,208,525 R142W probably damaging Het
Myo5c A G 9: 75,273,611 I761V probably benign Het
Neb T A 2: 52,176,812 K5879M probably damaging Het
Nkd2 C T 13: 73,822,786 V226M probably damaging Het
Olfr1459 T A 19: 13,146,086 H191L probably benign Het
Olfr645 T G 7: 104,084,564 H172P possibly damaging Het
Parp4 T A 14: 56,595,399 L393* probably null Het
Pcdhgb6 G A 18: 37,743,555 V439I probably benign Het
Pde1a T A 2: 80,128,792 T15S probably benign Het
Pgr T A 9: 8,900,979 I171N probably benign Het
Podxl T A 6: 31,526,245 D296V probably benign Het
Polr3e A T 7: 120,940,467 E479V possibly damaging Het
Prdm10 A T 9: 31,341,252 H427L possibly damaging Het
Prl5a1 A T 13: 28,142,555 K5* probably null Het
Prph A G 15: 99,057,123 S325G probably damaging Het
Rabl2 C A 15: 89,584,352 W49L probably benign Het
Rbbp8nl T A 2: 180,280,974 I209F probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn7a T C 2: 66,700,766 D589G probably benign Het
Sdr42e1 A T 8: 117,663,197 L235Q possibly damaging Het
Serpina3a T C 12: 104,116,001 M11T probably benign Het
Slc6a4 A T 11: 77,018,358 K399* probably null Het
Slco4c1 T A 1: 96,839,283 T337S probably damaging Het
Spc25 A T 2: 69,197,211 F112L probably damaging Het
Swt1 A G 1: 151,407,614 S331P probably benign Het
Tab1 A T 15: 80,155,770 K264* probably null Het
Tagln3 T A 16: 45,724,338 probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbck A G 3: 132,694,428 D80G probably benign Het
Tcim A T 8: 24,438,895 M1K probably null Het
Thap2 A G 10: 115,372,926 S37P unknown Het
Tjp2 A T 19: 24,099,603 probably null Het
Tln1 G A 4: 43,533,145 S2390L probably damaging Het
Trpm5 T G 7: 143,073,182 I1101L probably benign Het
Ttc3 T G 16: 94,442,695 M831R probably benign Het
Tulp3 A G 6: 128,323,087 C459R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Unc13b A T 4: 43,165,800 T195S possibly damaging Het
Urgcp A G 11: 5,716,691 L549P probably benign Het
Usp10 G T 8: 119,941,838 A293S probably benign Het
Vmn2r23 A G 6: 123,704,400 E89G possibly damaging Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Wif1 T C 10: 121,034,461 I40T possibly damaging Het
Zmynd8 G A 2: 165,898,947 R6C possibly damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTAGCTGGGGAGAACAATTG -3'
(R):5'- TGTAAAAGTAGTGGGAAAGTGCTTC -3'

Sequencing Primer
(F):5'- CTGGGGAGAACAATTGAGAATGTTG -3'
(R):5'- CTAGAGAGATGGCTCAGCACTC -3'
Posted On2018-02-28