Incidental Mutation 'R6244:Kmo'
ID505421
Institutional Source Beutler Lab
Gene Symbol Kmo
Ensembl Gene ENSMUSG00000039783
Gene Namekynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location175620381-175662116 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 175659695 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 404 (T404I)
Ref Sequence ENSEMBL: ENSMUSP00000095067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027809] [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]
Predicted Effect probably benign
Transcript: ENSMUST00000027809
SMART Domains Protein: ENSMUSP00000027809
Gene: ENSMUSG00000026525

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7tm_1 56 307 4.7e-36 PFAM
low complexity region 314 331 N/A INTRINSIC
low complexity region 363 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040250
AA Change: T438I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783
AA Change: T438I

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097458
AA Change: T404I

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783
AA Change: T404I

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140474
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrion outer membrane protein that catalyzes the hydroxylation of L-tryptophan metabolite, L-kynurenine, to form L-3-hydroxykynurenine. Studies in yeast identified this gene as a therapeutic target for Huntington disease. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack kynurenine 3-monooxygenase activity and altered levels of several tryptophan metabolites. Mice homozygous for another null allele exhibit increased LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Kmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Kmo APN 1 175655095 missense possibly damaging 0.54
IGL01734:Kmo APN 1 175655102 missense probably benign 0.00
IGL02415:Kmo APN 1 175649323 splice site probably benign
IGL02551:Kmo APN 1 175637919 missense probably damaging 1.00
IGL02866:Kmo APN 1 175653588 missense probably damaging 1.00
IGL03140:Kmo APN 1 175649220 missense probably damaging 1.00
R0613:Kmo UTSW 1 175637892 missense probably damaging 1.00
R0617:Kmo UTSW 1 175647190 missense possibly damaging 0.85
R0883:Kmo UTSW 1 175647140 missense possibly damaging 0.70
R1034:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1037:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1164:Kmo UTSW 1 175658559 missense probably benign 0.00
R1519:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1519:Kmo UTSW 1 175656802 missense probably damaging 1.00
R1712:Kmo UTSW 1 175656723 missense probably benign
R1796:Kmo UTSW 1 175637895 missense probably benign 0.00
R1938:Kmo UTSW 1 175651588 missense possibly damaging 0.88
R4531:Kmo UTSW 1 175659707 unclassified probably null
R4586:Kmo UTSW 1 175650572 missense probably damaging 1.00
R4586:Kmo UTSW 1 175650573 missense possibly damaging 0.90
R4603:Kmo UTSW 1 175651642 missense probably benign 0.13
R4647:Kmo UTSW 1 175659774 nonsense probably null
R4728:Kmo UTSW 1 175656763 missense possibly damaging 0.51
R5569:Kmo UTSW 1 175655122 missense probably benign 0.04
R5571:Kmo UTSW 1 175647194 missense possibly damaging 0.46
R6109:Kmo UTSW 1 175637908 missense possibly damaging 0.67
R6943:Kmo UTSW 1 175658375 missense probably benign 0.00
R7148:Kmo UTSW 1 175651602 missense probably damaging 1.00
R7319:Kmo UTSW 1 175653655 missense probably damaging 0.97
R7450:Kmo UTSW 1 175639100 missense probably benign 0.01
X0027:Kmo UTSW 1 175647193 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACGATTATGAGACACCCC -3'
(R):5'- AGGAATCAAACATTTGCTACCCAG -3'

Sequencing Primer
(F):5'- AAAAGCTGGACATAGCACATATCTG -3'
(R):5'- CCCAGAACTTTGACACTATGGTTGG -3'
Posted On2018-02-28