Incidental Mutation 'R6244:Atp9a'
ID505428
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6244 (G1)
Quality Score213.009
Status Validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 168689352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000151610] [ENSMUST00000156397] [ENSMUST00000178504]
Predicted Effect probably null
Transcript: ENSMUST00000029060
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109175
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109176
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109177
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140188
Predicted Effect probably benign
Transcript: ENSMUST00000151610
SMART Domains Protein: ENSMUSP00000121364
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156397
SMART Domains Protein: ENSMUSP00000119732
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
SCOP:d1eula_ 83 189 6e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178504
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACTGACCGAGGCTCATG -3'
(R):5'- AGCCCCAGGGAAAGACATTC -3'

Sequencing Primer
(F):5'- GCTCATGGGCCTACAAACAC -3'
(R):5'- GAAAGACATTCCTTTTAACAGGTGAC -3'
Posted On2018-02-28