Incidental Mutation 'R6244:Cenpc1'
ID505442
Institutional Source Beutler Lab
Gene Symbol Cenpc1
Ensembl Gene ENSMUSG00000029253
Gene Namecentromere protein C1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86012024-86065583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86046385 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 174 (R174M)
Ref Sequence ENSEMBL: ENSMUSP00000031170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031170]
Predicted Effect probably damaging
Transcript: ENSMUST00000031170
AA Change: R174M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031170
Gene: ENSMUSG00000029253
AA Change: R174M

DomainStartEndE-ValueType
Pfam:CENP_C_N 7 121 6.1e-42 PFAM
Pfam:CENP_C_N 115 261 2.6e-46 PFAM
Pfam:CENP-C_mid 265 519 5.4e-100 PFAM
PDB:4INM|W 700 724 5e-9 PDB
Pfam:CENP-C_C 819 903 3.9e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199392
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: This gene encodes a centromeric protein component of a nucleosome-associated complex that plays a central role in kinetochore protein assembly, mitotic progression and chromosome segregation. The human ortholog encodes a protein with DNA-binding activity, that associates constitutively to kinetochores throughout the cell cycle, as part of a prekinetochore complex, together with centromeric protein-A and centromeric protein-B. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Cenpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Cenpc1 APN 5 86037528 missense probably benign 0.02
IGL01287:Cenpc1 APN 5 86022454 nonsense probably null
IGL01363:Cenpc1 APN 5 86046531 nonsense probably null
IGL01720:Cenpc1 APN 5 86045425 missense possibly damaging 0.84
IGL02217:Cenpc1 APN 5 86029200 splice site probably benign
IGL02665:Cenpc1 APN 5 86046403 missense probably benign 0.01
IGL03022:Cenpc1 APN 5 86022375 splice site probably benign
IGL03162:Cenpc1 APN 5 86037905 missense possibly damaging 0.94
IGL03343:Cenpc1 APN 5 86016322 missense probably damaging 0.96
R0130:Cenpc1 UTSW 5 86046546 missense probably benign 0.07
R0193:Cenpc1 UTSW 5 86032403 missense probably benign 0.30
R0314:Cenpc1 UTSW 5 86037371 missense probably benign 0.20
R0932:Cenpc1 UTSW 5 86037600 missense possibly damaging 0.94
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0974:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R1240:Cenpc1 UTSW 5 86035510 missense probably benign 0.32
R1454:Cenpc1 UTSW 5 86013510 missense possibly damaging 0.71
R1677:Cenpc1 UTSW 5 86061998 splice site probably benign
R2044:Cenpc1 UTSW 5 86037755 missense probably benign 0.01
R2256:Cenpc1 UTSW 5 86016203 missense probably damaging 1.00
R3085:Cenpc1 UTSW 5 86037617 missense probably benign 0.01
R4516:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4518:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4561:Cenpc1 UTSW 5 86047632 missense probably damaging 1.00
R4827:Cenpc1 UTSW 5 86034431 missense possibly damaging 0.67
R4864:Cenpc1 UTSW 5 86045321 missense probably damaging 1.00
R5222:Cenpc1 UTSW 5 86037747 missense possibly damaging 0.77
R5707:Cenpc1 UTSW 5 86035434 missense possibly damaging 0.82
R5920:Cenpc1 UTSW 5 86020910 missense probably benign 0.00
R5999:Cenpc1 UTSW 5 86012263 missense probably damaging 1.00
R6073:Cenpc1 UTSW 5 86058153 critical splice donor site probably null
R6209:Cenpc1 UTSW 5 86033650 missense probably benign 0.02
R6278:Cenpc1 UTSW 5 86035535 missense probably damaging 0.97
R6395:Cenpc1 UTSW 5 86035570 missense probably benign 0.14
R7269:Cenpc1 UTSW 5 86013507 missense probably damaging 1.00
R7269:Cenpc1 UTSW 5 86032418 missense probably benign 0.12
R7335:Cenpc1 UTSW 5 86034353 missense possibly damaging 0.95
R7378:Cenpc1 UTSW 5 86046499 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGTCTTAATTACTGTGTGTCTGC -3'
(R):5'- ACCATGGTGCGTCTGATGAATTG -3'

Sequencing Primer
(F):5'- GATACTGAACTCTGGTTACCGGAC -3'
(R):5'- GGACTTATGTGTTGGCTCCCC -3'
Posted On2018-02-28