Incidental Mutation 'R6244:Adgrv1'
ID505480
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Nameadhesion G protein-coupled receptor V1
SynonymsMass1, Mgr1, VLGR1, Gpr98
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location81095068-81633154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81106931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 211 (T211I)
Ref Sequence ENSEMBL: ENSMUSP00000153419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585] [ENSMUST00000128120] [ENSMUST00000224088]
Predicted Effect probably damaging
Transcript: ENSMUST00000095585
AA Change: T6191I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: T6191I

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125698
SMART Domains Protein: ENSMUSP00000120136
Gene: ENSMUSG00000069170

DomainStartEndE-ValueType
Pfam:Calx-beta 1 47 2e-9 PFAM
Pfam:Calx-beta 79 180 4e-11 PFAM
Pfam:Calx-beta 194 304 9.2e-4 PFAM
Pfam:Calx-beta 354 425 2.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128120
AA Change: T211I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122358
Gene: ENSMUSG00000069170
AA Change: T211I

DomainStartEndE-ValueType
Pfam:7tm_2 1 161 4.4e-8 PFAM
low complexity region 247 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181508
Predicted Effect probably damaging
Transcript: ENSMUST00000224088
AA Change: T211I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225082
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81405408 critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81472877 splice site probably benign
IGL00471:Adgrv1 APN 13 81509542 missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81489074 missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81506187 missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81524684 missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81578230 missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81397203 missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81540119 missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81382291 missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81489028 missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81419351 missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81405399 missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81419128 missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81557065 missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81557158 missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81466184 missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81419631 missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81567342 missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81529049 missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81472394 critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81182783 missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81446430 missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81557309 missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81556996 missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81568743 splice site probably benign
IGL02016:Adgrv1 APN 13 81397453 missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81579790 missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81427664 missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81559195 unclassified probably null
IGL02328:Adgrv1 APN 13 81578175 missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81459713 missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81559424 missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81479670 missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81435556 splice site probably benign
IGL02603:Adgrv1 APN 13 81488952 missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81511619 missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81578872 missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81563732 missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81520739 missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81579714 missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81433636 missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81523612 missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81578854 missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81442480 missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81472899 missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81559529 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81382373 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81433700 missense probably benign 0.02
IGL03169:Adgrv1 APN 13 81503900 missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81433618 missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81446478 missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81106898 splice site probably null
IGL03343:Adgrv1 APN 13 81283388 missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81499058 missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81481336 missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81563632 missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81517967 missense probably damaging 0.99
beatle UTSW 13 81579594 nonsense probably null
Metronome UTSW 13 81435559 critical splice donor site probably null
nome UTSW 13 81391767 missense probably benign 0.00
F2404:Adgrv1 UTSW 13 81420006 missense probably benign 0.13
I2288:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0087:Adgrv1 UTSW 13 81386951 missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0131:Adgrv1 UTSW 13 81502995 unclassified probably benign
R0218:Adgrv1 UTSW 13 81106898 splice site probably null
R0325:Adgrv1 UTSW 13 81540015 missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81474993 missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81385953 missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81397226 nonsense probably null
R0466:Adgrv1 UTSW 13 81566296 missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81489035 missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81559150 missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81528442 splice site probably benign
R0532:Adgrv1 UTSW 13 81578896 missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81573318 missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81528530 missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81475105 missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81503004 missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81570556 missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81499125 missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81479742 nonsense probably null
R0962:Adgrv1 UTSW 13 81405346 missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81557063 missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81440037 splice site probably benign
R1310:Adgrv1 UTSW 13 81566377 missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81528865 missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81493176 missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81386788 missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81095450 missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81433513 missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81579619 missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81472580 critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81556957 missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81593048 missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81503978 unclassified probably null
R1579:Adgrv1 UTSW 13 81563779 missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81466160 critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81559117 missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81424288 missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81487853 missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81476631 missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81559552 missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81593060 missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81487947 missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81506146 missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81489077 missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81504113 missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81544533 missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81563566 missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81592551 splice site probably benign
R1928:Adgrv1 UTSW 13 81520786 missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81391757 missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81510911 missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81523749 missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81595182 missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81561469 missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81529013 missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81492537 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419535 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419950 missense probably benign 0.02
R2127:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81581727 missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81524557 critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81445320 missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81566290 missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81506140 missense probably benign
R2260:Adgrv1 UTSW 13 81568374 missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81595179 missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81540132 frame shift probably null
R2910:Adgrv1 UTSW 13 81557119 missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81448865 missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81581747 missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81543542 missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81524600 missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81419475 missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81499043 missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81593102 missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81283367 start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81440072 missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81435705 missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81578772 missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81475047 missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81182789 missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81540132 frame shift probably null
R4003:Adgrv1 UTSW 13 81540132 frame shift probably null
R4194:Adgrv1 UTSW 13 81498996 missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81440192 missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81492910 missense unknown
R4388:Adgrv1 UTSW 13 81581709 missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81566302 missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81374256 missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81419230 missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81440066 missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81419808 missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81494569 splice site probably null
R4647:Adgrv1 UTSW 13 81528795 nonsense probably null
R4657:Adgrv1 UTSW 13 81405364 missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81433525 missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81106919 missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81095445 missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81155231 nonsense probably null
R4816:Adgrv1 UTSW 13 81528674 missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81560844 missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81503001 critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81533122 intron probably benign
R4897:Adgrv1 UTSW 13 81561585 splice site probably null
R4906:Adgrv1 UTSW 13 81270738 splice site probably null
R4917:Adgrv1 UTSW 13 81510877 missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81578734 missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81459829 missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81488931 missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81528821 missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81592585 missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81095487 missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81419427 missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81439441 missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81435674 missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81283416 start gained probably benign
R5203:Adgrv1 UTSW 13 81510905 missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81488929 nonsense probably null
R5280:Adgrv1 UTSW 13 81397465 missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81521084 missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81578253 missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81476690 missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81529046 missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81494657 missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81459715 missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81419308 missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81424258 missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81445244 missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81419389 missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81433689 missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81476564 missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81405267 missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81155276 missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81521117 missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81472500 missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81522236 missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81103302 missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81424271 missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81397451 missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81107075 missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81386866 missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81442501 missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81435559 critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81466259 missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81397423 nonsense probably null
R6024:Adgrv1 UTSW 13 81476505 missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81397354 missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81391695 missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81427745 missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81506076 missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81182774 missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81419259 missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81386005 missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81433838 missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81459763 synonymous probably null
R6190:Adgrv1 UTSW 13 81524779 splice site probably null
R6215:Adgrv1 UTSW 13 81579594 nonsense probably null
R6216:Adgrv1 UTSW 13 81524471 intron probably null
R6238:Adgrv1 UTSW 13 81466283 missense probably benign 0.07
R6298:Adgrv1 UTSW 13 81391767 missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81499068 missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81385981 missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81414583 missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81508736 missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81575101 unclassified probably null
R6467:Adgrv1 UTSW 13 81444538 missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81559490 missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81567343 missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81433652 missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81506179 missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81487962 missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81481515 missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81437557 missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81493210 missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81472478 missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81472953 missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81557081 missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81155154 critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81433494 missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81528701 missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81508669 missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81567490 missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81520997 missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81559270 missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81386926 missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81543392 missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81476672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCCAAATCGCTCACAGGAC -3'
(R):5'- TTTAGCTGAGCTGGCCAGATG -3'

Sequencing Primer
(F):5'- TCGCTCACAGGACAGAAAAG -3'
(R):5'- TGGCCAGATGACCTTTGACATAC -3'
Posted On2018-02-28