Incidental Mutation 'R6245:Ddx31'
ID505502
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R6245 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location28840406-28905571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28844982 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 52 (F52I)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037117] [ENSMUST00000113853] [ENSMUST00000171404]
Predicted Effect probably benign
Transcript: ENSMUST00000037117
SMART Domains Protein: ENSMUSP00000042265
Gene: ENSMUSG00000035666

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:TFIIIC_delta 59 250 1.1e-45 PFAM
low complexity region 609 621 N/A INTRINSIC
Pfam:zf-TFIIIC 728 816 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113853
AA Change: F52I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: F52I

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156468
Predicted Effect probably benign
Transcript: ENSMUST00000171404
SMART Domains Protein: ENSMUSP00000132171
Gene: ENSMUSG00000035666

DomainStartEndE-ValueType
Pfam:TFIIIC_delta 7 109 3.1e-17 PFAM
low complexity region 468 480 N/A INTRINSIC
Pfam:zf-TFIIIC 587 676 4.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,178,418 Y218H probably benign Het
Abca9 A G 11: 110,135,423 I937T probably damaging Het
Adgrl3 T A 5: 81,688,556 N720K probably benign Het
Akr1c21 T G 13: 4,575,232 V54G possibly damaging Het
Alpi G T 1: 87,100,834 D111E probably damaging Het
Armc3 C T 2: 19,248,705 T219M probably damaging Het
Bms1 T A 6: 118,396,836 E780V probably damaging Het
Ccdc159 T C 9: 21,935,568 S244P probably damaging Het
Cdon T C 9: 35,476,939 W737R probably damaging Het
Chdh T A 14: 30,035,305 V395D probably damaging Het
Col22a1 C A 15: 71,973,816 D366Y probably damaging Het
Crnkl1 T A 2: 145,928,131 N264I probably benign Het
Ctnnd2 T C 15: 30,905,748 L847P probably damaging Het
Cyp4a31 A C 4: 115,571,348 T382P possibly damaging Het
Dcaf8 A T 1: 172,165,867 M1L probably benign Het
Eps15 G A 4: 109,382,866 S852N possibly damaging Het
Fchsd1 A T 18: 37,962,775 L552Q probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frem2 T C 3: 53,655,824 M421V probably benign Het
Gm1110 T G 9: 26,920,747 H36P probably benign Het
Gm11639 A T 11: 104,785,008 Y1542F probably benign Het
Hadha C T 5: 30,120,044 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Intu C A 3: 40,675,326 T362K probably damaging Het
Jaml C T 9: 45,097,919 T248I probably damaging Het
Kcnj1 A T 9: 32,396,867 S176C probably damaging Het
Kcnj9 A G 1: 172,326,137 L140P probably damaging Het
Kif7 T C 7: 79,702,143 K957R probably damaging Het
Klc4 T A 17: 46,636,679 I366F probably damaging Het
Lamb2 A G 9: 108,488,199 probably null Het
Madd T C 2: 91,178,104 D151G probably benign Het
Man2a1 C A 17: 64,710,826 A689E probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msmp T C 4: 43,583,909 Y48C probably damaging Het
Muc6 T C 7: 141,648,821 N567S probably damaging Het
Nrap A G 19: 56,354,221 Y748H probably damaging Het
Nrap C T 19: 56,379,875 A192T possibly damaging Het
Olfr1138 G C 2: 87,737,896 Q143E possibly damaging Het
Olfr1370 T A 13: 21,072,690 T204S possibly damaging Het
Olfr1384 T A 11: 49,514,165 F176I possibly damaging Het
Pcdhb8 T G 18: 37,357,169 D633E possibly damaging Het
Pcdhb9 G A 18: 37,403,154 V734M probably damaging Het
Plscr1 T C 9: 92,259,321 Y21H unknown Het
Ptk2b G T 14: 66,163,066 P767T probably damaging Het
Ptprz1 T C 6: 23,051,990 Y1424H probably damaging Het
Sec31a T A 5: 100,386,184 Q118L probably benign Het
Selenop A G 15: 3,274,734 S21G probably damaging Het
Shank1 G A 7: 44,352,253 S1132N unknown Het
Slf1 A G 13: 77,084,383 L534P probably damaging Het
Sparcl1 T A 5: 104,085,147 H596L probably damaging Het
Spocd1 C T 4: 129,957,108 probably null Het
Tbc1d24 A T 17: 24,185,993 I59N probably damaging Het
Tctex1d1 A G 4: 102,988,667 N32S probably benign Het
Tjp3 G A 10: 81,277,276 T580I probably benign Het
Tmem154 C T 3: 84,684,296 T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 V894I probably benign Het
Trbv20 A T 6: 41,188,906 L88F possibly damaging Het
Tssk2 A C 16: 17,898,948 I72L possibly damaging Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Vmn2r104 A T 17: 20,041,567 F434I possibly damaging Het
Vmn2r42 T C 7: 8,192,734 N471S probably damaging Het
Vmn2r94 C G 17: 18,258,123 G121R probably damaging Het
Wdr72 T C 9: 74,148,223 S245P probably damaging Het
Zbtb42 A G 12: 112,679,535 Y48C probably damaging Het
Zdbf2 T C 1: 63,304,433 V657A possibly damaging Het
Zfp768 A T 7: 127,344,091 C288* probably null Het
Zfp988 T A 4: 147,332,013 C301* probably null Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R0729:Ddx31 UTSW 2 28874174 missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28857175 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28874173 missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28844842 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6647:Ddx31 UTSW 2 28875738 missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28874176 missense probably benign 0.26
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTTCATGGACTAATGCACCTC -3'
(R):5'- TCACTACAGTGCTGCAGAGG -3'

Sequencing Primer
(F):5'- ATGGACTAATGCACCTCTTCTTG -3'
(R):5'- CTACAGTGCTGCAGAGGAAAGAC -3'
Posted On2018-02-28