Incidental Mutation 'R6245:Muc6'
ID 505529
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Name mucin 6, gastric
Synonyms
MMRRC Submission 044403-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R6245 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141213373-141241641 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141235086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 567 (N567S)
Ref Sequence ENSEMBL: ENSMUSP00000140388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000062451
AA Change: N608S

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: N608S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000189314
AA Change: N567S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191
AA Change: N567S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190907
AA Change: N608S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: N608S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,026,249 (GRCm39) I937T probably damaging Het
Adgrl3 T A 5: 81,836,403 (GRCm39) N720K probably benign Het
Akr1c21 T G 13: 4,625,231 (GRCm39) V54G possibly damaging Het
Alpi G T 1: 87,028,556 (GRCm39) D111E probably damaging Het
Armc3 C T 2: 19,253,516 (GRCm39) T219M probably damaging Het
Bms1 T A 6: 118,373,797 (GRCm39) E780V probably damaging Het
Ccdc159 T C 9: 21,846,864 (GRCm39) S244P probably damaging Het
Cdon T C 9: 35,388,235 (GRCm39) W737R probably damaging Het
Chdh T A 14: 29,757,262 (GRCm39) V395D probably damaging Het
Col22a1 C A 15: 71,845,665 (GRCm39) D366Y probably damaging Het
Cplane1 T C 15: 8,207,902 (GRCm39) Y218H probably benign Het
Crnkl1 T A 2: 145,770,051 (GRCm39) N264I probably benign Het
Ctnnd2 T C 15: 30,905,894 (GRCm39) L847P probably damaging Het
Cyp4a31 A C 4: 115,428,545 (GRCm39) T382P possibly damaging Het
Dcaf8 A T 1: 171,993,434 (GRCm39) M1L probably benign Het
Ddx31 T A 2: 28,734,994 (GRCm39) F52I probably benign Het
Dynlt5 A G 4: 102,845,864 (GRCm39) N32S probably benign Het
Efcab3 A T 11: 104,675,834 (GRCm39) Y1542F probably benign Het
Eps15 G A 4: 109,240,063 (GRCm39) S852N possibly damaging Het
Fchsd1 A T 18: 38,095,828 (GRCm39) L552Q probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Frem2 T C 3: 53,563,245 (GRCm39) M421V probably benign Het
Gm1110 T G 9: 26,832,043 (GRCm39) H36P probably benign Het
Hadha C T 5: 30,325,042 (GRCm39) probably null Het
Hspa4 C T 11: 53,153,766 (GRCm39) E702K probably benign Het
Intu C A 3: 40,629,756 (GRCm39) T362K probably damaging Het
Jaml C T 9: 45,009,217 (GRCm39) T248I probably damaging Het
Kcnj1 A T 9: 32,308,163 (GRCm39) S176C probably damaging Het
Kcnj9 A G 1: 172,153,704 (GRCm39) L140P probably damaging Het
Kif7 T C 7: 79,351,891 (GRCm39) K957R probably damaging Het
Klc4 T A 17: 46,947,605 (GRCm39) I366F probably damaging Het
Lamb2 A G 9: 108,365,398 (GRCm39) probably null Het
Madd T C 2: 91,008,449 (GRCm39) D151G probably benign Het
Man2a1 C A 17: 65,017,821 (GRCm39) A689E probably damaging Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Msmp T C 4: 43,583,909 (GRCm39) Y48C probably damaging Het
Nrap A G 19: 56,342,653 (GRCm39) Y748H probably damaging Het
Nrap C T 19: 56,368,307 (GRCm39) A192T possibly damaging Het
Or2p2 T A 13: 21,256,860 (GRCm39) T204S possibly damaging Het
Or2y14 T A 11: 49,404,992 (GRCm39) F176I possibly damaging Het
Or5w15 G C 2: 87,568,240 (GRCm39) Q143E possibly damaging Het
Pcdhb8 T G 18: 37,490,222 (GRCm39) D633E possibly damaging Het
Pcdhb9 G A 18: 37,536,207 (GRCm39) V734M probably damaging Het
Plscr1 T C 9: 92,141,374 (GRCm39) Y21H unknown Het
Ptk2b G T 14: 66,400,515 (GRCm39) P767T probably damaging Het
Ptprz1 T C 6: 23,051,989 (GRCm39) Y1424H probably damaging Het
Sec31a T A 5: 100,534,043 (GRCm39) Q118L probably benign Het
Selenop A G 15: 3,304,216 (GRCm39) S21G probably damaging Het
Shank1 G A 7: 44,001,677 (GRCm39) S1132N unknown Het
Slf1 A G 13: 77,232,502 (GRCm39) L534P probably damaging Het
Sparcl1 T A 5: 104,233,013 (GRCm39) H596L probably damaging Het
Spocd1 C T 4: 129,850,901 (GRCm39) probably null Het
Tbc1d24 A T 17: 24,404,967 (GRCm39) I59N probably damaging Het
Tjp3 G A 10: 81,113,110 (GRCm39) T580I probably benign Het
Tmem154 C T 3: 84,591,603 (GRCm39) T51M possibly damaging Het
Tmem8b G A 4: 43,690,246 (GRCm39) V894I probably benign Het
Trbv20 A T 6: 41,165,840 (GRCm39) L88F possibly damaging Het
Tssk2 A C 16: 17,716,812 (GRCm39) I72L possibly damaging Het
Tub T A 7: 108,626,265 (GRCm39) I267N probably damaging Het
Vmn2r104 A T 17: 20,261,829 (GRCm39) F434I possibly damaging Het
Vmn2r42 T C 7: 8,195,733 (GRCm39) N471S probably damaging Het
Vmn2r94 C G 17: 18,478,385 (GRCm39) G121R probably damaging Het
Wdr72 T C 9: 74,055,505 (GRCm39) S245P probably damaging Het
Zbtb42 A G 12: 112,645,969 (GRCm39) Y48C probably damaging Het
Zdbf2 T C 1: 63,343,592 (GRCm39) V657A possibly damaging Het
Zfp768 A T 7: 126,943,263 (GRCm39) C288* probably null Het
Zfp988 T A 4: 147,416,470 (GRCm39) C301* probably null Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL00466:Muc6 APN 7 141,232,169 (GRCm39) missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141,638,890 (GRCm38) missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141,234,333 (GRCm39) nonsense probably null
IGL01021:Muc6 APN 7 141,217,075 (GRCm39) missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141,234,720 (GRCm39) missense probably damaging 1.00
IGL01294:Muc6 APN 7 141,232,926 (GRCm39) missense probably damaging 1.00
IGL01449:Muc6 APN 7 141,218,527 (GRCm39) missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141,237,572 (GRCm39) missense probably damaging 1.00
IGL01539:Muc6 APN 7 141,236,306 (GRCm39) missense probably benign 0.07
IGL01541:Muc6 APN 7 141,236,069 (GRCm39) nonsense probably null
IGL01810:Muc6 APN 7 141,237,327 (GRCm39) missense probably damaging 0.97
IGL01941:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL01954:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL02096:Muc6 APN 7 141,226,117 (GRCm39) intron probably benign
IGL02192:Muc6 APN 7 141,217,717 (GRCm39) missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141,235,889 (GRCm39) missense probably damaging 1.00
IGL02234:Muc6 APN 7 141,226,842 (GRCm39) missense probably benign 0.09
IGL02302:Muc6 APN 7 141,227,763 (GRCm39) missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141,226,726 (GRCm39) missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141,216,853 (GRCm39) missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141,235,843 (GRCm39) splice site probably benign
IGL02851:Muc6 APN 7 141,234,627 (GRCm39) missense probably damaging 1.00
IGL03026:Muc6 APN 7 141,226,414 (GRCm39) intron probably benign
IGL03070:Muc6 APN 7 141,230,834 (GRCm39) splice site probably benign
IGL03108:Muc6 APN 7 141,217,402 (GRCm39) missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141,238,324 (GRCm39) missense probably damaging 1.00
IGL03366:Muc6 APN 7 141,234,349 (GRCm39) missense probably damaging 1.00
anticipation UTSW 7 141,214,363 (GRCm39) frame shift probably null
F5770:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R0153:Muc6 UTSW 7 141,214,029 (GRCm39) missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141,216,868 (GRCm39) missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141,238,548 (GRCm39) missense probably benign 0.01
R0499:Muc6 UTSW 7 141,226,735 (GRCm39) missense probably benign
R0503:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141,218,497 (GRCm39) missense probably benign 0.06
R0792:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0880:Muc6 UTSW 7 141,217,270 (GRCm39) missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141,230,500 (GRCm39) missense probably damaging 0.99
R1174:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1175:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1189:Muc6 UTSW 7 141,232,122 (GRCm39) missense probably damaging 1.00
R1259:Muc6 UTSW 7 141,226,464 (GRCm39) intron probably benign
R1293:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R1295:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1296:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1471:Muc6 UTSW 7 141,234,176 (GRCm39) missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1548:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1548:Muc6 UTSW 7 141,238,368 (GRCm39) splice site probably benign
R1576:Muc6 UTSW 7 141,214,437 (GRCm39) missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141,234,265 (GRCm39) missense probably damaging 1.00
R1702:Muc6 UTSW 7 141,236,752 (GRCm39) missense probably damaging 1.00
R1792:Muc6 UTSW 7 141,214,371 (GRCm39) missense probably benign 0.41
R1924:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141,217,011 (GRCm39) missense probably damaging 0.99
R1964:Muc6 UTSW 7 141,226,330 (GRCm39) intron probably benign
R1964:Muc6 UTSW 7 141,226,329 (GRCm39) nonsense probably null
R1975:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R2031:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141,213,991 (GRCm39) missense probably benign 0.23
R2201:Muc6 UTSW 7 141,236,075 (GRCm39) missense probably damaging 1.00
R2218:Muc6 UTSW 7 141,233,227 (GRCm39) missense probably benign 0.41
R2245:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141,217,837 (GRCm39) missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141,217,444 (GRCm39) missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141,226,651 (GRCm39) missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141,216,951 (GRCm39) missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141,234,946 (GRCm39) splice site probably benign
R3872:Muc6 UTSW 7 141,226,867 (GRCm39) missense probably benign
R4029:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141,234,920 (GRCm39) missense probably damaging 1.00
R4126:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141,217,576 (GRCm39) missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141,226,356 (GRCm39) intron probably benign
R4509:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141,230,489 (GRCm39) missense probably benign 0.03
R4594:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141,224,212 (GRCm39) intron probably benign
R4678:Muc6 UTSW 7 141,230,554 (GRCm39) missense probably benign 0.09
R4737:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4737:Muc6 UTSW 7 141,226,426 (GRCm39) intron probably benign
R4981:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5012:Muc6 UTSW 7 141,216,570 (GRCm39) missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141,226,795 (GRCm39) missense probably benign
R5027:Muc6 UTSW 7 141,216,349 (GRCm39) missense probably benign 0.01
R5058:Muc6 UTSW 7 141,230,491 (GRCm39) missense probably benign 0.01
R5069:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5126:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5168:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5179:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141,237,375 (GRCm39) missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141,217,836 (GRCm39) missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141,235,078 (GRCm39) missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141,216,448 (GRCm39) missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141,235,850 (GRCm39) critical splice donor site probably null
R5800:Muc6 UTSW 7 141,226,690 (GRCm39) splice site probably benign
R5808:Muc6 UTSW 7 141,226,360 (GRCm39) intron probably benign
R5865:Muc6 UTSW 7 141,236,769 (GRCm39) missense probably damaging 0.97
R5919:Muc6 UTSW 7 141,227,837 (GRCm39) missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141,234,640 (GRCm39) missense probably damaging 1.00
R6126:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141,226,792 (GRCm39) missense probably benign
R6236:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6254:Muc6 UTSW 7 141,237,380 (GRCm39) missense probably benign 0.09
R6418:Muc6 UTSW 7 141,224,032 (GRCm39) intron probably benign
R6609:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6610:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6611:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6623:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6626:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6817:Muc6 UTSW 7 141,237,326 (GRCm39) missense probably damaging 0.99
R6923:Muc6 UTSW 7 141,217,453 (GRCm39) missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141,226,246 (GRCm39) intron probably benign
R7001:Muc6 UTSW 7 141,217,320 (GRCm39) missense probably damaging 0.99
R7046:Muc6 UTSW 7 141,226,456 (GRCm39) intron probably benign
R7097:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7099:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7101:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7107:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7108:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7112:Muc6 UTSW 7 141,235,542 (GRCm39) missense probably damaging 1.00
R7202:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7204:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7205:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7222:Muc6 UTSW 7 141,214,428 (GRCm39) missense unknown
R7230:Muc6 UTSW 7 141,235,479 (GRCm39) missense probably damaging 1.00
R7278:Muc6 UTSW 7 141,226,842 (GRCm39) missense probably benign 0.09
R7483:Muc6 UTSW 7 141,224,245 (GRCm39) missense unknown
R7501:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7601:Muc6 UTSW 7 141,216,454 (GRCm39) missense unknown
R7641:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7644:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7645:Muc6 UTSW 7 141,234,923 (GRCm39) missense probably benign 0.40
R7659:Muc6 UTSW 7 141,216,973 (GRCm39) missense possibly damaging 0.53
R7674:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7679:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7680:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7689:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7690:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7760:Muc6 UTSW 7 141,237,322 (GRCm39) splice site probably null
R7806:Muc6 UTSW 7 141,217,387 (GRCm39) missense possibly damaging 0.53
R7809:Muc6 UTSW 7 141,226,638 (GRCm39) missense probably benign 0.02
R7848:Muc6 UTSW 7 141,232,188 (GRCm39) missense possibly damaging 0.53
R7859:Muc6 UTSW 7 141,231,687 (GRCm39) missense probably damaging 0.96
R8054:Muc6 UTSW 7 141,231,748 (GRCm39) missense probably damaging 1.00
R8085:Muc6 UTSW 7 141,226,729 (GRCm39) missense unknown
R8130:Muc6 UTSW 7 141,233,354 (GRCm39) missense probably damaging 0.97
R8210:Muc6 UTSW 7 141,235,673 (GRCm39) critical splice donor site probably null
R8273:Muc6 UTSW 7 141,226,795 (GRCm39) missense unknown
R8294:Muc6 UTSW 7 141,217,263 (GRCm39) missense possibly damaging 0.96
R8329:Muc6 UTSW 7 141,226,525 (GRCm39) missense unknown
R8379:Muc6 UTSW 7 141,230,579 (GRCm39) nonsense probably null
R8537:Muc6 UTSW 7 141,234,184 (GRCm39) missense probably benign 0.03
R8736:Muc6 UTSW 7 141,228,439 (GRCm39) missense possibly damaging 0.53
R8767:Muc6 UTSW 7 141,229,549 (GRCm39) missense probably damaging 1.00
R8902:Muc6 UTSW 7 141,233,791 (GRCm39) missense possibly damaging 0.93
R9009:Muc6 UTSW 7 141,217,018 (GRCm39) missense possibly damaging 0.73
R9010:Muc6 UTSW 7 141,226,351 (GRCm39) missense unknown
R9023:Muc6 UTSW 7 141,237,432 (GRCm39) nonsense probably null
R9058:Muc6 UTSW 7 141,218,154 (GRCm39) missense possibly damaging 0.61
R9257:Muc6 UTSW 7 141,226,738 (GRCm39) missense unknown
R9495:Muc6 UTSW 7 141,237,398 (GRCm39) missense probably damaging 0.98
R9563:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9645:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9659:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
R9733:Muc6 UTSW 7 141,216,310 (GRCm39) missense unknown
R9787:Muc6 UTSW 7 141,227,748 (GRCm39) nonsense probably null
R9788:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
V7581:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
V7583:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
X0026:Muc6 UTSW 7 141,237,964 (GRCm39) missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
Z1177:Muc6 UTSW 7 141,237,656 (GRCm39) missense probably benign 0.20
Z1177:Muc6 UTSW 7 141,236,701 (GRCm39) missense probably benign 0.29
Z1177:Muc6 UTSW 7 141,217,827 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AACACACTGCCCTTCTTCAGG -3'
(R):5'- TTAATCAAAGGGGCACAGCTGG -3'

Sequencing Primer
(F):5'- CTGTTCCCATCCCAATGA -3'
(R):5'- CTGGAGAGGGGAGAGCTTTTG -3'
Posted On 2018-02-28