Incidental Mutation 'R6248:Ncor1'
ID505619
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Namenuclear receptor co-repressor 1
Synonyms5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6248 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location62316426-62458541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62366982 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 329 (P329S)
Ref Sequence ENSEMBL: ENSMUSP00000122654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000151498] [ENSMUST00000155712]
Predicted Effect probably damaging
Transcript: ENSMUST00000018645
AA Change: P1013S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: P1013S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101066
AA Change: P1013S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: P1013S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101067
AA Change: P963S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: P963S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101068
Predicted Effect probably damaging
Transcript: ENSMUST00000151498
AA Change: P603S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501
AA Change: P603S

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000155712
AA Change: P329S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: P329S

DomainStartEndE-ValueType
low complexity region 26 47 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 303 311 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 352 365 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
coiled coil region 982 1019 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
low complexity region 1239 1250 N/A INTRINSIC
low complexity region 1306 1325 N/A INTRINSIC
PDB:3N00|B 1334 1354 3e-7 PDB
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1427 1438 N/A INTRINSIC
PDB:2OVM|B 1537 1560 2e-8 PDB
low complexity region 1581 1594 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161116
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 160,075,408 S83P possibly damaging Het
Actr10 A T 12: 70,952,959 E176D probably benign Het
Adcy3 G A 12: 4,208,662 probably null Het
AI429214 T A 8: 36,994,124 I142N probably damaging Het
Alox12 A G 11: 70,253,110 L148S probably damaging Het
Ank3 A G 10: 69,973,850 I1147V probably benign Het
Apoc2 C T 7: 19,673,568 V12I probably benign Het
Arap3 T C 18: 37,991,354 S311G probably benign Het
Arih2 G T 9: 108,611,642 H292Q probably damaging Het
Cdc14a A T 3: 116,308,194 D312E probably benign Het
Cdh12 T G 15: 21,237,714 W12G possibly damaging Het
Cisd2 A T 3: 135,408,855 N118K probably damaging Het
Cntnap5b A G 1: 100,072,102 Q195R probably benign Het
Cyp2r1 A G 7: 114,562,731 probably null Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 T A 2: 180,660,255 H1952L probably damaging Het
Dnah10 T A 5: 124,794,219 probably null Het
Dnal4 T A 15: 79,762,513 M56L probably damaging Het
Emilin2 A G 17: 71,274,117 V538A probably benign Het
Eps8l2 A G 7: 141,342,102 D31G probably damaging Het
Erp44 A T 4: 48,219,479 L112* probably null Het
Etl4 C T 2: 20,809,089 T1907I possibly damaging Het
Exoc3 A G 13: 74,182,281 F510L probably benign Het
Fam114a2 G T 11: 57,493,116 T324K possibly damaging Het
Fer1l4 G A 2: 156,046,171 R465C probably damaging Het
Frmd4b A C 6: 97,459,212 S2R probably benign Het
Fscn1 A T 5: 142,961,023 D192V possibly damaging Het
Gm15922 C A 7: 3,736,338 E510D probably benign Het
Gm3486 T A 14: 41,484,515 *200C probably null Het
Gusb A T 5: 130,000,525 H138Q probably benign Het
Hdac9 A T 12: 34,528,294 M4K possibly damaging Het
Hhipl1 G T 12: 108,318,705 R439L probably benign Het
Hoxd9 A G 2: 74,698,636 E194G probably benign Het
Itgb1 A G 8: 128,722,421 S503G possibly damaging Het
Kcnt2 T A 1: 140,509,478 C500S probably damaging Het
Kdm7a G A 6: 39,147,049 S727L possibly damaging Het
Klhdc4 A G 8: 121,813,768 F92L probably damaging Het
Klrb1a A G 6: 128,619,174 V62A probably damaging Het
Krit1 A G 5: 3,813,032 probably null Het
Krt40 A G 11: 99,541,740 I150T possibly damaging Het
Larp4b A G 13: 9,158,702 T464A probably benign Het
Lrrc52 T G 1: 167,466,395 D107A probably damaging Het
Mapkap1 G T 2: 34,518,680 V35F probably damaging Het
Mccc1 A G 3: 35,990,164 V171A probably damaging Het
Metap1d A T 2: 71,515,760 R222* probably null Het
Mrgpre G A 7: 143,780,866 A300V probably benign Het
Mterf1b C A 5: 4,196,606 N82K probably benign Het
Myh9 C T 15: 77,785,222 W533* probably null Het
Myom2 A G 8: 15,098,472 probably null Het
Nr2f1 T C 13: 78,196,492 probably benign Het
Olfr1348 A T 7: 6,501,676 C183* probably null Het
Olfr1361 A T 13: 21,659,074 I83N possibly damaging Het
Olfr417 T G 1: 174,369,670 V251G probably benign Het
Olfr47 C T 6: 43,235,904 Q99* probably null Het
Olfr551 T C 7: 102,588,030 T238A probably benign Het
Olfr800 A G 10: 129,660,663 I286V probably benign Het
Olfr96 T A 17: 37,225,560 L145* probably null Het
Pcdha11 T C 18: 37,005,897 L193P probably benign Het
Pcdhb20 T A 18: 37,506,232 F604I probably damaging Het
Pde1a T C 2: 79,878,201 H291R probably damaging Het
Pfkm G A 15: 98,126,379 V423M probably damaging Het
Pkd2l1 G T 19: 44,157,669 Q149K probably benign Het
Pkhd1l1 T A 15: 44,529,559 N1763K probably benign Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Prpf39 A C 12: 65,042,754 N89H probably damaging Het
Rad54l2 A G 9: 106,710,338 F743L probably damaging Het
Raver2 A G 4: 101,134,123 probably null Het
Ric8b T C 10: 84,947,845 L189P probably damaging Het
Sccpdh T C 1: 179,668,392 F13L probably benign Het
Scd2 T C 19: 44,303,009 F296L probably damaging Het
Scg2 G T 1: 79,436,306 D233E probably benign Het
Sema5b C A 16: 35,628,007 probably null Het
Skint5 A T 4: 113,779,089 V644E unknown Het
Slc44a5 G T 3: 154,264,041 V612F possibly damaging Het
Snd1 C T 6: 28,520,235 R107* probably null Het
Sun5 G T 2: 153,860,669 T189K probably damaging Het
Tap1 A T 17: 34,193,177 E452V probably damaging Het
Tcam1 A G 11: 106,282,826 N32S probably benign Het
Tep1 T C 14: 50,830,258 E2167G probably damaging Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmem175 T C 5: 108,645,955 V317A probably damaging Het
Tsga13 A G 6: 30,897,204 V231A probably benign Het
Tspan12 A G 6: 21,799,971 S126P probably damaging Het
Uvrag G T 7: 98,988,191 D143E probably damaging Het
Vmn1r230 T A 17: 20,846,774 M75K possibly damaging Het
Vmn2r120 A T 17: 57,545,287 F10I probably benign Het
Vmn2r57 T C 7: 41,399,860 T822A probably benign Het
Vmn2r67 T C 7: 85,150,560 Y490C probably damaging Het
Zc3h7b T A 15: 81,783,185 W644R probably damaging Het
Zeb1 A G 18: 5,766,962 D491G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp831 A T 2: 174,644,515 T328S possibly damaging Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62392528 missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62325486 critical splice donor site probably null
IGL01392:Ncor1 APN 11 62340594 missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62340474 missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62334584 missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62349347 intron probably benign
IGL01889:Ncor1 APN 11 62334601 missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62344637 missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62419609 missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62358917 missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62329659 unclassified probably benign
IGL02288:Ncor1 APN 11 62349403 missense probably benign 0.01
IGL02348:Ncor1 APN 11 62333659 splice site probably benign
IGL02608:Ncor1 APN 11 62373214 missense probably benign 0.07
LCD18:Ncor1 UTSW 11 62419782 critical splice acceptor site probably benign
R0026:Ncor1 UTSW 11 62438429 missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62392595 missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62410920 missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62373322 missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62333776 missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62333777 missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62343230 missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62334040 missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62403806 missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62334631 missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62378504 missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62423005 missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62384784 missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62327112 missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62381419 missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62338158 missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62349385 missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62325601 missense probably benign 0.43
R3708:Ncor1 UTSW 11 62344687 missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62373357 missense probably benign 0.00
R3923:Ncor1 UTSW 11 62325616 missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62344757 missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62329668 intron probably null
R4350:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4351:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4359:Ncor1 UTSW 11 62358910 missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62344834 missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62378612 missense probably benign 0.26
R4863:Ncor1 UTSW 11 62392638 missense possibly damaging 0.92
R4875:Ncor1 UTSW 11 62433611 small deletion probably benign
R4956:Ncor1 UTSW 11 62340605 missense probably damaging 1.00
R4993:Ncor1 UTSW 11 62343341 missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62345237 missense possibly damaging 0.92
R5144:Ncor1 UTSW 11 62349464 missense probably damaging 1.00
R5223:Ncor1 UTSW 11 62339000 missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62338962 missense probably damaging 1.00
R5271:Ncor1 UTSW 11 62340545 missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62392649 missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62343011 missense probably benign 0.00
R5580:Ncor1 UTSW 11 62389778 nonsense probably null
R5593:Ncor1 UTSW 11 62369304 missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62358853 unclassified probably null
R5632:Ncor1 UTSW 11 62338234 missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62344763 missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62383190 missense probably damaging 1.00
R5973:Ncor1 UTSW 11 62349310 intron probably null
R6013:Ncor1 UTSW 11 62321077 missense probably benign
R6019:Ncor1 UTSW 11 62373161 missense probably benign 0.00
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62317849 missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62419617 missense probably damaging 0.98
R6281:Ncor1 UTSW 11 62373545 missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62373298 missense probably benign 0.30
R6469:Ncor1 UTSW 11 62343302 missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62381414 nonsense probably null
R6614:Ncor1 UTSW 11 62330819 missense probably benign 0.01
R6650:Ncor1 UTSW 11 62334541 missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62373446 missense probably benign 0.01
R6852:Ncor1 UTSW 11 62343245 missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62329486 missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62353233 critical splice donor site probably null
R7054:Ncor1 UTSW 11 62384793 missense probably null
X0065:Ncor1 UTSW 11 62354569 critical splice donor site probably null
X0065:Ncor1 UTSW 11 62358991 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACAGGAACAGGTGACTTGTTTC -3'
(R):5'- GGTTTCTTGCACTCCATGTAATATACC -3'

Sequencing Primer
(F):5'- GGAACAGGTGACTTGTTTCAAAAAC -3'
(R):5'- CCAATTGGAACGCCCGTAAGTG -3'
Posted On2018-02-28