Incidental Mutation 'R6248:Adcy3'
ID505623
Institutional Source Beutler Lab
Gene Symbol Adcy3
Ensembl Gene ENSMUSG00000020654
Gene Nameadenylate cyclase 3
SynonymsAC3
Accession Numbers

Ncbi RefSeq: NM_138305.3, NM_001159536.1, NM_001159537.1; MGI:99675

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R6248 (G1)
Quality Score208.009
Status Validated
Chromosome12
Chromosomal Location4133103-4213525 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 4208662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020981] [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000140975] [ENSMUST00000152065]
Predicted Effect probably benign
Transcript: ENSMUST00000020981
SMART Domains Protein: ENSMUSP00000020981
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
Pfam:CENP-O 1 74 2.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020984
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124505
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127110
Predicted Effect probably null
Transcript: ENSMUST00000127756
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140975
SMART Domains Protein: ENSMUSP00000119136
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 117 231 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146523
Predicted Effect probably null
Transcript: ENSMUST00000152065
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152792
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (92/92)
MGI Phenotype Strain: 2661086; 3604495
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one mutation of this gene display impaired olfaction and disorganization of glomeruli in the main olfactory bulb. Mutant animals also appear to be sterile as homozygous matings failed to produce litters. Mice with another mutant allele fail to survive beyond weaning. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 160,075,408 S83P possibly damaging Het
Actr10 A T 12: 70,952,959 E176D probably benign Het
AI429214 T A 8: 36,994,124 I142N probably damaging Het
Alox12 A G 11: 70,253,110 L148S probably damaging Het
Ank3 A G 10: 69,973,850 I1147V probably benign Het
Apoc2 C T 7: 19,673,568 V12I probably benign Het
Arap3 T C 18: 37,991,354 S311G probably benign Het
Arih2 G T 9: 108,611,642 H292Q probably damaging Het
Cdc14a A T 3: 116,308,194 D312E probably benign Het
Cdh12 T G 15: 21,237,714 W12G possibly damaging Het
Cisd2 A T 3: 135,408,855 N118K probably damaging Het
Cntnap5b A G 1: 100,072,102 Q195R probably benign Het
Cyp2r1 A G 7: 114,562,731 probably null Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 T A 2: 180,660,255 H1952L probably damaging Het
Dnah10 T A 5: 124,794,219 probably null Het
Dnal4 T A 15: 79,762,513 M56L probably damaging Het
Emilin2 A G 17: 71,274,117 V538A probably benign Het
Eps8l2 A G 7: 141,342,102 D31G probably damaging Het
Erp44 A T 4: 48,219,479 L112* probably null Het
Etl4 C T 2: 20,809,089 T1907I possibly damaging Het
Exoc3 A G 13: 74,182,281 F510L probably benign Het
Fam114a2 G T 11: 57,493,116 T324K possibly damaging Het
Fer1l4 G A 2: 156,046,171 R465C probably damaging Het
Frmd4b A C 6: 97,459,212 S2R probably benign Het
Fscn1 A T 5: 142,961,023 D192V possibly damaging Het
Gm15922 C A 7: 3,736,338 E510D probably benign Het
Gm3486 T A 14: 41,484,515 *200C probably null Het
Gusb A T 5: 130,000,525 H138Q probably benign Het
Hdac9 A T 12: 34,528,294 M4K possibly damaging Het
Hhipl1 G T 12: 108,318,705 R439L probably benign Het
Hoxd9 A G 2: 74,698,636 E194G probably benign Het
Itgb1 A G 8: 128,722,421 S503G possibly damaging Het
Kcnt2 T A 1: 140,509,478 C500S probably damaging Het
Kdm7a G A 6: 39,147,049 S727L possibly damaging Het
Klhdc4 A G 8: 121,813,768 F92L probably damaging Het
Klrb1a A G 6: 128,619,174 V62A probably damaging Het
Krit1 A G 5: 3,813,032 probably null Het
Krt40 A G 11: 99,541,740 I150T possibly damaging Het
Larp4b A G 13: 9,158,702 T464A probably benign Het
Lrrc52 T G 1: 167,466,395 D107A probably damaging Het
Mapkap1 G T 2: 34,518,680 V35F probably damaging Het
Mccc1 A G 3: 35,990,164 V171A probably damaging Het
Metap1d A T 2: 71,515,760 R222* probably null Het
Mrgpre G A 7: 143,780,866 A300V probably benign Het
Mterf1b C A 5: 4,196,606 N82K probably benign Het
Myh9 C T 15: 77,785,222 W533* probably null Het
Myom2 A G 8: 15,098,472 probably null Het
Ncor1 G A 11: 62,366,982 P329S probably damaging Het
Nr2f1 T C 13: 78,196,492 probably benign Het
Olfr1348 A T 7: 6,501,676 C183* probably null Het
Olfr1361 A T 13: 21,659,074 I83N possibly damaging Het
Olfr417 T G 1: 174,369,670 V251G probably benign Het
Olfr47 C T 6: 43,235,904 Q99* probably null Het
Olfr551 T C 7: 102,588,030 T238A probably benign Het
Olfr800 A G 10: 129,660,663 I286V probably benign Het
Olfr96 T A 17: 37,225,560 L145* probably null Het
Pcdha11 T C 18: 37,005,897 L193P probably benign Het
Pcdhb20 T A 18: 37,506,232 F604I probably damaging Het
Pde1a T C 2: 79,878,201 H291R probably damaging Het
Pfkm G A 15: 98,126,379 V423M probably damaging Het
Pkd2l1 G T 19: 44,157,669 Q149K probably benign Het
Pkhd1l1 T A 15: 44,529,559 N1763K probably benign Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Prpf39 A C 12: 65,042,754 N89H probably damaging Het
Rad54l2 A G 9: 106,710,338 F743L probably damaging Het
Raver2 A G 4: 101,134,123 probably null Het
Ric8b T C 10: 84,947,845 L189P probably damaging Het
Sccpdh T C 1: 179,668,392 F13L probably benign Het
Scd2 T C 19: 44,303,009 F296L probably damaging Het
Scg2 G T 1: 79,436,306 D233E probably benign Het
Sema5b C A 16: 35,628,007 probably null Het
Skint5 A T 4: 113,779,089 V644E unknown Het
Slc44a5 G T 3: 154,264,041 V612F possibly damaging Het
Snd1 C T 6: 28,520,235 R107* probably null Het
Sun5 G T 2: 153,860,669 T189K probably damaging Het
Tap1 A T 17: 34,193,177 E452V probably damaging Het
Tcam1 A G 11: 106,282,826 N32S probably benign Het
Tep1 T C 14: 50,830,258 E2167G probably damaging Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmem175 T C 5: 108,645,955 V317A probably damaging Het
Tsga13 A G 6: 30,897,204 V231A probably benign Het
Tspan12 A G 6: 21,799,971 S126P probably damaging Het
Uvrag G T 7: 98,988,191 D143E probably damaging Het
Vmn1r230 T A 17: 20,846,774 M75K possibly damaging Het
Vmn2r120 A T 17: 57,545,287 F10I probably benign Het
Vmn2r57 T C 7: 41,399,860 T822A probably benign Het
Vmn2r67 T C 7: 85,150,560 Y490C probably damaging Het
Zc3h7b T A 15: 81,783,185 W644R probably damaging Het
Zeb1 A G 18: 5,766,962 D491G probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp831 A T 2: 174,644,515 T328S possibly damaging Het
Other mutations in Adcy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adcy3 APN 12 4194357 missense probably damaging 1.00
IGL00985:Adcy3 APN 12 4134600 missense probably damaging 0.98
IGL01735:Adcy3 APN 12 4201213 missense probably benign 0.00
IGL02097:Adcy3 APN 12 4212118 missense probably damaging 1.00
IGL02102:Adcy3 APN 12 4134699 missense probably damaging 1.00
IGL02103:Adcy3 APN 12 4134390 missense possibly damaging 0.69
IGL02155:Adcy3 APN 12 4212142 nonsense probably null
IGL02376:Adcy3 APN 12 4201031 missense possibly damaging 0.77
IGL02411:Adcy3 APN 12 4209407 unclassified probably null
IGL02465:Adcy3 APN 12 4200906 missense probably benign 0.10
IGL02819:Adcy3 APN 12 4206986 splice site probably benign
magnificent_frigatebird UTSW 12 4194324 missense
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0918:Adcy3 UTSW 12 4198360 missense probably benign 0.05
R1480:Adcy3 UTSW 12 4212171 missense probably damaging 1.00
R1736:Adcy3 UTSW 12 4200998 missense possibly damaging 0.87
R1885:Adcy3 UTSW 12 4134951 missense probably damaging 1.00
R1897:Adcy3 UTSW 12 4173450 splice site probably benign
R1951:Adcy3 UTSW 12 4208624 missense probably benign 0.29
R2083:Adcy3 UTSW 12 4173512 missense probably damaging 1.00
R2417:Adcy3 UTSW 12 4208627 missense probably benign 0.05
R4379:Adcy3 UTSW 12 4134558 missense probably damaging 1.00
R4785:Adcy3 UTSW 12 4206542 missense probably benign 0.00
R4960:Adcy3 UTSW 12 4134896 missense probably benign 0.11
R5001:Adcy3 UTSW 12 4198434 missense possibly damaging 0.56
R5166:Adcy3 UTSW 12 4134438 missense probably damaging 1.00
R5375:Adcy3 UTSW 12 4210870 missense probably damaging 1.00
R5416:Adcy3 UTSW 12 4209308 missense probably damaging 1.00
R5998:Adcy3 UTSW 12 4198348 missense probably damaging 1.00
R6490:Adcy3 UTSW 12 4212150 missense probably damaging 1.00
R6566:Adcy3 UTSW 12 4194324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCACCGTGATCGATTGATTG -3'
(R):5'- GGCTAGCATTTCAGTGAACACC -3'

Sequencing Primer
(F):5'- CCACCGTGATCGATTGATTGATTGTG -3'
(R):5'- ATACCCGGGTGAGTGCAG -3'
Posted On2018-02-28