Incidental Mutation 'R6247:Ankhd1'
ID505738
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission 044366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6247 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36654146 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2300 (T2300A)
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably benign
Transcript: ENSMUST00000006205
AA Change: T2300A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: T2300A

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000037072
AA Change: T789A
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: T789A

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116653
Predicted Effect unknown
Transcript: ENSMUST00000140061
AA Change: T312A
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483
AA Change: T312A

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142977
AA Change: T2300A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: T2300A

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155329
AA Change: T2300A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: T2300A

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,158,942 D871G probably benign Het
A4galt G T 15: 83,227,819 H254Q probably damaging Het
AA986860 C A 1: 130,743,043 T334K possibly damaging Het
Abca13 T C 11: 9,403,874 I3732T probably benign Het
Abcf1 C T 17: 35,961,064 D353N probably damaging Het
Adssl1 A G 12: 112,628,356 H83R probably damaging Het
Amer2 C A 14: 60,378,872 A172E probably damaging Het
Ano5 G A 7: 51,566,131 probably null Het
Apob G A 12: 8,001,801 G1109D probably damaging Het
Arhgef26 A T 3: 62,380,960 N484Y probably damaging Het
C6 A G 15: 4,763,541 D376G probably damaging Het
Caml T C 13: 55,625,173 probably null Het
Capn12 T C 7: 28,888,652 L473S probably benign Het
Cdk6 G A 5: 3,344,553 probably null Het
Cers5 A T 15: 99,745,924 C153S probably benign Het
Cfap206 T C 4: 34,692,530 M499V probably benign Het
Chd6 A G 2: 160,950,048 M2463T probably damaging Het
Chn1 T C 2: 73,707,006 E58G possibly damaging Het
Clec4a1 T C 6: 122,928,042 V100A probably benign Het
Col7a1 G C 9: 108,981,062 probably benign Het
Csmd1 A G 8: 16,196,235 V1050A possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd5a A T 7: 109,898,682 C1044S probably damaging Het
Dnah7b A G 1: 46,225,888 T2181A probably benign Het
Dnaic1 T C 4: 41,605,775 V255A probably benign Het
Dync2h1 A G 9: 7,135,078 C1518R probably damaging Het
Dysf T C 6: 84,066,999 V273A probably damaging Het
Eif1 C T 11: 100,320,397 probably benign Het
Eml3 T C 19: 8,930,949 I58T probably benign Het
Fam171b T A 2: 83,879,208 I408N probably damaging Het
Fchsd2 A G 7: 101,253,540 E351G probably benign Het
Focad G A 4: 88,407,140 A81T possibly damaging Het
Fpr-rs4 G A 17: 18,022,486 V252I probably benign Het
Fryl A G 5: 73,065,481 L1919P probably damaging Het
Gm12185 C T 11: 48,915,908 R152H probably damaging Het
Gm14410 C T 2: 177,193,724 G249E probably damaging Het
Gm3854 T C 7: 6,353,946 C253R probably damaging Het
Gm6685 A T 11: 28,339,706 S37T possibly damaging Het
Greb1 G A 12: 16,716,675 P374L probably damaging Het
Hdac4 A T 1: 92,012,838 probably null Het
Hecw1 A T 13: 14,234,425 L1099* probably null Het
Hivep1 T C 13: 42,157,490 S1069P probably benign Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Kif9 A G 9: 110,488,544 M96V possibly damaging Het
Kncn T A 4: 115,884,790 V18E probably damaging Het
Lrrc74a G A 12: 86,758,556 G384D probably damaging Het
Ltb4r2 T C 14: 55,762,651 V243A probably damaging Het
Mtnr1b T A 9: 15,862,786 I326L probably benign Het
Mylip C T 13: 45,408,481 T253I probably damaging Het
Necap1 T A 6: 122,880,652 probably null Het
Nedd4 C T 9: 72,726,438 P409S probably damaging Het
Npat A T 9: 53,545,238 E36D probably damaging Het
Ovch2 C T 7: 107,785,441 V490M probably damaging Het
Pax9 T C 12: 56,709,695 S273P probably benign Het
Plce1 A G 19: 38,745,845 E1563G probably damaging Het
Podxl2 C A 6: 88,849,317 G336* probably null Het
Prdm1 A G 10: 44,446,786 probably null Het
Psme4 T C 11: 30,853,245 I29T possibly damaging Het
Ptprd A T 4: 76,066,291 D780E probably benign Het
Retsat T C 6: 72,604,935 M294T probably benign Het
Robo2 A T 16: 73,967,784 V652D probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Serpinb3d G T 1: 107,082,760 T66K probably benign Het
Setd1b A T 5: 123,158,398 probably benign Het
Slc7a10 G T 7: 35,186,587 A36S possibly damaging Het
Sstr3 T A 15: 78,539,588 I320F probably damaging Het
Syne1 G T 10: 5,349,071 A1005E probably damaging Het
Syngap1 C A 17: 26,962,957 S975* probably null Het
Tinagl1 C T 4: 130,172,932 C124Y probably null Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmem104 A G 11: 115,243,993 T451A probably benign Het
Tmem141 T C 2: 25,621,681 probably null Het
Tmem184a C A 5: 139,813,072 V41L probably benign Het
Tmem39b C T 4: 129,686,791 V303I possibly damaging Het
Tsn T C 1: 118,305,209 I122V probably benign Het
Ttc41 G T 10: 86,776,663 V1267L probably benign Het
Uggt1 A T 1: 36,163,228 L1096Q probably damaging Het
Usp50 A T 2: 126,775,793 I244N probably benign Het
Vil1 A G 1: 74,432,339 S760G probably benign Het
Wasf1 T A 10: 40,937,745 V541E unknown Het
Zc3h13 G T 14: 75,343,736 S1721I probably benign Het
Zfp180 G T 7: 24,105,105 K316N probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp759 A G 13: 67,140,460 T692A probably benign Het
Zfyve26 A G 12: 79,282,984 V476A probably benign Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTTTCCTATAGAGAGATTGGGTG -3'
(R):5'- GTACCCTGAAACAAATGGCTTAAC -3'

Sequencing Primer
(F):5'- TCCTATAGAGAGATTGGGTGATATTC -3'
(R):5'- ACAAATGGCTTAACAACTTATTCAAG -3'
Posted On2018-02-28