Incidental Mutation 'R6246:Chst14'
ID505751
Institutional Source Beutler Lab
Gene Symbol Chst14
Ensembl Gene ENSMUSG00000074916
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Synonyms2600016L03Rik, D4ST-1, D4st1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R6246 (G1)
Quality Score208.009
Status Validated
Chromosome2
Chromosomal Location118926496-118928585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118927001 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 117 (C117Y)
Ref Sequence ENSEMBL: ENSMUSP00000106461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000099546] [ENSMUST00000110837]
Predicted Effect probably benign
Transcript: ENSMUST00000036578
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099546
AA Change: C117Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099579
Gene: ENSMUSG00000074916
AA Change: C117Y

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 139 365 1.6e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110837
AA Change: C117Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106461
Gene: ENSMUSG00000074916
AA Change: C117Y

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 135 340 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HNK-1 family of sulfotransferases. The encoded protein transfers sulfate to the C-4 hydroxyl of N-acetylgalactosamine residues in dermatan sulfate. Mutations in this gene have been associated with adducted thumb-clubfoot syndrome.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accelerated peripheral nerve regeneration, decreased body weight, premature death, fragile skin and background sensitive abnormal fertility, kinked tail and tooth growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cdhr2 T C 13: 54,719,710 V451A probably damaging Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Cic C T 7: 25,271,642 T266M probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Flrt3 A G 2: 140,659,801 Y636H probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Guf1 G A 5: 69,558,555 G113R probably damaging Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Krt72 T C 15: 101,780,937 K320R probably damaging Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Muc16 A T 9: 18,577,067 probably null Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Spag6 G A 2: 18,699,095 probably null Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Chst14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0506:Chst14 UTSW 2 118927721 missense probably damaging 1.00
R1468:Chst14 UTSW 2 118927664 missense probably damaging 1.00
R1468:Chst14 UTSW 2 118927664 missense probably damaging 1.00
R1640:Chst14 UTSW 2 118926898 missense probably damaging 1.00
R1892:Chst14 UTSW 2 118927349 missense probably damaging 1.00
R1899:Chst14 UTSW 2 118927015 missense possibly damaging 0.62
R6056:Chst14 UTSW 2 118927733 missense probably damaging 1.00
R6236:Chst14 UTSW 2 118927516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTGATGTTCGCTGTAATCG -3'
(R):5'- CACGTTGTTCAGGATGCCAG -3'

Sequencing Primer
(F):5'- ACTGCTGCTCATGATCGAG -3'
(R):5'- TTCAGGATGCCAGCCAGC -3'
Posted On2018-02-28