Incidental Mutation 'R6246:Flrt3'
ID505756
Institutional Source Beutler Lab
Gene Symbol Flrt3
Ensembl Gene ENSMUSG00000051379
Gene Namefibronectin leucine rich transmembrane protein 3
Synonyms5530600M07Rik, C430047I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6246 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location140650914-140671469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140659801 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 636 (Y636H)
Ref Sequence ENSEMBL: ENSMUSP00000105684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056760] [ENSMUST00000078027] [ENSMUST00000110057] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect probably damaging
Transcript: ENSMUST00000056760
AA Change: Y636H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053399
Gene: ENSMUSG00000051379
AA Change: Y636H

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078027
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110057
AA Change: Y636H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105684
Gene: ENSMUSG00000051379
AA Change: Y636H

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110063
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172544
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRTs may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. This gene is expressed in many tissues. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, abnormal embryonic tissue development, disrupted head formation, cardia bifida and abnormal ventral wall closure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cdhr2 T C 13: 54,719,710 V451A probably damaging Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Chst14 G A 2: 118,927,001 C117Y probably damaging Het
Cic C T 7: 25,271,642 T266M probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Guf1 G A 5: 69,558,555 G113R probably damaging Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Krt72 T C 15: 101,780,937 K320R probably damaging Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Muc16 A T 9: 18,577,067 probably null Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Spag6 G A 2: 18,699,095 probably null Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Flrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Flrt3 APN 2 140660688 missense probably damaging 0.99
IGL02292:Flrt3 APN 2 140660125 missense probably damaging 1.00
R0030:Flrt3 UTSW 2 140660317 missense probably damaging 1.00
R1487:Flrt3 UTSW 2 140660934 missense probably damaging 1.00
R2061:Flrt3 UTSW 2 140661453 missense probably damaging 1.00
R2115:Flrt3 UTSW 2 140661503 missense probably damaging 1.00
R2326:Flrt3 UTSW 2 140661391 missense possibly damaging 0.50
R3113:Flrt3 UTSW 2 140661534 missense probably benign 0.03
R3605:Flrt3 UTSW 2 140661367 missense probably damaging 1.00
R4366:Flrt3 UTSW 2 140660407 missense probably damaging 0.99
R4702:Flrt3 UTSW 2 140661655 missense probably benign
R4799:Flrt3 UTSW 2 140660166 missense probably damaging 1.00
R5085:Flrt3 UTSW 2 140660257 missense probably damaging 0.99
R5100:Flrt3 UTSW 2 140671384 start gained probably null
R5109:Flrt3 UTSW 2 140660743 missense possibly damaging 0.51
R5635:Flrt3 UTSW 2 140660500 missense probably damaging 1.00
R5982:Flrt3 UTSW 2 140660916 missense possibly damaging 0.95
R6117:Flrt3 UTSW 2 140660445 missense possibly damaging 0.46
R6213:Flrt3 UTSW 2 140661165 missense probably damaging 1.00
R6746:Flrt3 UTSW 2 140660025 missense probably damaging 0.99
R6854:Flrt3 UTSW 2 140660718 missense probably damaging 1.00
R7000:Flrt3 UTSW 2 140660884 nonsense probably null
R7221:Flrt3 UTSW 2 140661170 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAGCAACCTGAAATCTG -3'
(R):5'- GATGACTATGCAGAAGCCGG -3'

Sequencing Primer
(F):5'- CAGTAGAACAGAGTTCCTACC -3'
(R):5'- CTATGCAGAAGCCGGTACTAAG -3'
Posted On2018-02-28