Incidental Mutation 'R6246:Cic'
ID505779
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R6246 (G1)
Quality Score186.009
Status Validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25271642 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 266 (T266M)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: T266M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: T266M

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169392
SMART Domains Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,710,491 G315* probably null Het
2410089E03Rik T A 15: 8,210,014 L1233H probably damaging Het
Abca7 T A 10: 80,015,165 V2110E probably damaging Het
Acaca C A 11: 84,315,970 T1552K probably benign Het
AI314180 A G 4: 58,811,365 probably null Het
Aknad1 A G 3: 108,751,832 D54G probably damaging Het
Ano1 T C 7: 144,633,725 T435A possibly damaging Het
Azgp1 A G 5: 137,985,213 D50G possibly damaging Het
Bbx A G 16: 50,224,660 S513P probably benign Het
Ccdc114 A G 7: 45,936,364 I116V probably damaging Het
Ccdc129 A T 6: 55,967,672 K459N probably damaging Het
Ccdc85a C T 11: 28,576,897 S209N probably damaging Het
Cdca2 T A 14: 67,677,828 R661* probably null Het
Cdhr2 T C 13: 54,719,710 V451A probably damaging Het
Cenpt C T 8: 105,849,259 G152S possibly damaging Het
Chd9 A G 8: 90,932,417 T2A probably damaging Het
Chst14 G A 2: 118,927,001 C117Y probably damaging Het
Clec12a A T 6: 129,353,770 N105I possibly damaging Het
Cmah G A 13: 24,466,790 V525M probably damaging Het
Cpt1a T C 19: 3,376,550 L572P probably damaging Het
Crybg2 T C 4: 134,089,346 L1365P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg1 G A 16: 31,665,650 S32N probably benign Het
Dnah14 T C 1: 181,680,888 I1877T probably benign Het
Duox1 G T 2: 122,327,174 G594C probably damaging Het
Eci2 T C 13: 34,990,198 N127D probably damaging Het
Fam57b T A 7: 126,827,496 F30L probably damaging Het
Fat4 T C 3: 38,891,721 S1588P probably damaging Het
Fer1l4 T A 2: 156,024,982 I1489F probably damaging Het
Flrt3 A G 2: 140,659,801 Y636H probably damaging Het
Frmd5 T A 2: 121,551,048 H62L possibly damaging Het
Gm6309 A T 5: 146,170,240 Y99N probably damaging Het
Gm8225 T C 17: 26,543,678 V281A probably benign Het
Grsf1 A G 5: 88,662,592 L353P possibly damaging Het
Gtf2a1l A G 17: 88,671,547 R58G probably benign Het
Guf1 G A 5: 69,558,555 G113R probably damaging Het
Hfe A T 13: 23,708,229 F51I probably damaging Het
Hibch T C 1: 52,904,642 S250P probably damaging Het
Il1rap T A 16: 26,714,881 M509K probably benign Het
Il4ra T C 7: 125,576,405 V595A probably benign Het
Ints11 A G 4: 155,888,089 T460A probably benign Het
Kdm5a G A 6: 120,431,910 G1518E probably damaging Het
Khsrp T C 17: 57,025,324 D289G possibly damaging Het
Kif14 C T 1: 136,476,424 Q29* probably null Het
Krt72 T C 15: 101,780,937 K320R probably damaging Het
Lcmt2 A G 2: 121,140,389 L71P probably damaging Het
Lmo7 A T 14: 101,918,700 D1037V probably damaging Het
Lpo T C 11: 87,822,232 T15A unknown Het
Mia3 G T 1: 183,345,277 T7N probably damaging Het
Muc16 A T 9: 18,577,067 probably null Het
Mup9 T A 4: 60,419,810 Y29F probably damaging Het
Nisch T C 14: 31,172,559 D1105G probably damaging Het
Oip5 T C 2: 119,615,620 T136A probably benign Het
Olfr437 G A 6: 43,167,502 probably null Het
Osbpl10 C A 9: 115,226,774 N532K probably benign Het
P2ry12 C T 3: 59,217,529 V242I probably benign Het
Pdhx A T 2: 103,046,792 C26S probably damaging Het
Pgk2 A T 17: 40,207,424 I371K probably damaging Het
Phyhip T C 14: 70,467,055 V238A probably damaging Het
Pla2g4a G A 1: 149,872,587 T282I probably damaging Het
Pld5 A T 1: 175,963,909 C448* probably null Het
Plk1 T A 7: 122,169,436 I553N probably damaging Het
Ppp1r13l T A 7: 19,369,858 I88K probably benign Het
Rad54l2 A G 9: 106,700,493 probably null Het
Sept7 A G 9: 25,307,521 E428G probably benign Het
Serpina3j G A 12: 104,317,447 G268D probably damaging Het
Smc2 A T 4: 52,460,289 D555V probably damaging Het
Spag16 A T 1: 69,923,821 I376F probably benign Het
Spag6 G A 2: 18,699,095 probably null Het
Tecta T C 9: 42,377,908 I454V probably benign Het
Tm9sf1 C T 14: 55,636,370 R557H probably damaging Het
Traf5 C T 1: 192,070,553 E28K probably damaging Het
Trav23 G A 14: 53,977,428 E33K probably damaging Het
Trim32 T C 4: 65,614,564 S453P probably damaging Het
Tssk1 A G 16: 17,895,439 T363A probably benign Het
Txnrd3 A G 6: 89,651,541 N88S probably benign Het
Unc13b A G 4: 43,216,246 S182G probably benign Het
Vmn2r89 A T 14: 51,456,046 R284S probably damaging Het
Zbtb14 A G 17: 69,387,483 T59A possibly damaging Het
Zcchc2 T A 1: 106,030,066 S756T possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
V7732:Cic UTSW 7 25292245 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGAAGGCTATGACCTGCG -3'
(R):5'- CTAGAGCGAGTAACCCAGACAG -3'

Sequencing Primer
(F):5'- TATGACCTGCGGCAACTGAG -3'
(R):5'- CCAGACAGCCTCCTCAGG -3'
Posted On2018-02-28