Incidental Mutation 'R6249:Calcr'
ID505841
Institutional Source Beutler Lab
Gene Symbol Calcr
Ensembl Gene ENSMUSG00000023964
Gene Namecalcitonin receptor
SynonymsClr
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6249 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location3685680-3764714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3692711 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 381 (M381K)
Ref Sequence ENSEMBL: ENSMUSP00000132124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075644] [ENSMUST00000115622] [ENSMUST00000168592] [ENSMUST00000170266] [ENSMUST00000171613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075644
AA Change: M381K

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075070
Gene: ENSMUSG00000023964
AA Change: M381K

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 5.2e-85 PFAM
Pfam:Dicty_CAR 259 410 5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115622
AA Change: M344K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111285
Gene: ENSMUSG00000023964
AA Change: M344K

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168592
AA Change: M344K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130243
Gene: ENSMUSG00000023964
AA Change: M344K

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170266
AA Change: M381K

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132124
Gene: ENSMUSG00000023964
AA Change: M381K

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 2.2e-84 PFAM
Pfam:Dicty_CAR 257 399 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171613
AA Change: M344K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130083
Gene: ENSMUSG00000023964
AA Change: M344K

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Haploinsufficiency may result in increased bone density due to increased bone formation. Homozygous inactivation may result in embryonic lethality. Mice homozygous for another disruption allele at this locus show a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,103,270 S90C probably damaging Het
Abca9 T C 11: 110,145,627 D552G probably benign Het
Adgrb3 A G 1: 25,432,558 L502P probably damaging Het
Agmo T C 12: 37,243,838 probably null Het
Ank3 A G 10: 69,823,076 probably null Het
Apol11b G T 15: 77,635,337 T181K probably benign Het
Arap2 G T 5: 62,646,193 H1244N probably damaging Het
Arid1b A T 17: 5,279,361 M838L possibly damaging Het
Aste1 G A 9: 105,396,617 V19I probably benign Het
B3gnt3 A T 8: 71,692,662 M354K probably damaging Het
Ccdc63 A C 5: 122,124,999 L160W probably benign Het
Cerkl A G 2: 79,368,778 L156P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddb1 C A 19: 10,605,720 Y5* probably null Het
Fam205a1 A T 4: 42,850,528 W543R probably benign Het
Fignl2 T C 15: 101,054,179 E74G possibly damaging Het
Glb1l2 C T 9: 26,765,554 probably benign Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm16503 A G 4: 147,541,051 M1V probably null Het
Gm2696 A C 10: 77,794,812 probably benign Het
Gm45844 A G 7: 7,240,093 S20P probably benign Het
Gm7579 C T 7: 142,212,006 P50S unknown Het
Idh1 A G 1: 65,166,219 S196P probably damaging Het
Il1rap T C 16: 26,692,848 V214A possibly damaging Het
Kctd17 C G 15: 78,430,039 probably null Het
Lama1 G T 17: 67,798,604 V2036L probably benign Het
Lars G T 18: 42,257,206 probably null Het
Mdn1 T A 4: 32,708,484 V1670E possibly damaging Het
Mtmr7 A T 8: 40,581,482 I266N probably damaging Het
Ncapd3 GGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTG 9: 27,088,053 probably benign Het
Nckap5 T C 1: 126,024,930 E1295G probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Olfr1341 A G 4: 118,709,713 Y102C probably damaging Het
Olfr169 T A 16: 19,565,975 N303Y probably damaging Het
Olfr190 T C 16: 59,074,432 Y216C probably damaging Het
Olfr448 G T 6: 42,897,304 L284F probably damaging Het
Olfr635 A T 7: 103,979,611 S140C possibly damaging Het
Olfr907 T G 9: 38,499,584 I305R unknown Het
Pcdha4 T A 18: 36,953,676 V304E probably damaging Het
Pde6c T C 19: 38,158,560 probably null Het
Pebp4 A T 14: 70,059,650 T213S possibly damaging Het
Phf2 C A 13: 48,805,872 R886L unknown Het
Pik3ca A T 3: 32,461,563 H795L probably damaging Het
Pisd G T 5: 32,738,844 T379N probably damaging Het
Pld2 T C 11: 70,555,370 L732P probably damaging Het
Pskh1 A G 8: 105,912,985 D99G possibly damaging Het
Rest A G 5: 77,281,224 T497A probably benign Het
Rps24 C T 14: 24,493,462 T108M possibly damaging Het
Rtel1 C T 2: 181,351,682 R566C probably damaging Het
Scyl2 A G 10: 89,657,857 S350P possibly damaging Het
Slc38a7 G T 8: 95,837,674 probably null Het
Sox5 A G 6: 143,833,283 I674T probably benign Het
Surf4 C A 2: 26,926,887 E39D probably damaging Het
Tas2r144 T A 6: 42,215,357 Y10* probably null Het
Thbs4 C T 13: 92,774,707 G323R probably damaging Het
Top2b A G 14: 16,399,006 Y542C probably damaging Het
Trim61 A G 8: 65,014,456 V51A probably benign Het
Tyrp1 T A 4: 80,850,772 I501N possibly damaging Het
U2surp C T 9: 95,500,816 D32N probably benign Het
Ush1c T C 7: 46,214,959 Y411C probably damaging Het
Vwa7 G A 17: 35,023,389 V490I probably benign Het
Xylt1 G T 7: 117,667,305 A849S probably benign Het
Ythdc1 T A 5: 86,831,956 N599K possibly damaging Het
Zbtb38 T A 9: 96,685,992 Y1013F probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zswim9 T C 7: 13,260,977 S418G probably damaging Het
Other mutations in Calcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Calcr APN 6 3717196 missense probably damaging 1.00
IGL01146:Calcr APN 6 3700144 missense possibly damaging 0.88
IGL02253:Calcr APN 6 3707523 missense probably benign 0.12
IGL02567:Calcr APN 6 3691564 missense probably damaging 1.00
IGL02729:Calcr APN 6 3707595 missense probably benign
IGL03062:Calcr APN 6 3693718 missense probably benign 0.08
R0111:Calcr UTSW 6 3717157 missense probably damaging 1.00
R0561:Calcr UTSW 6 3692630 missense probably damaging 0.99
R1013:Calcr UTSW 6 3692621 missense probably damaging 1.00
R1628:Calcr UTSW 6 3700251 missense possibly damaging 0.53
R2152:Calcr UTSW 6 3687615 missense probably benign 0.03
R2206:Calcr UTSW 6 3717133 missense probably damaging 0.98
R2207:Calcr UTSW 6 3717133 missense probably damaging 0.98
R3403:Calcr UTSW 6 3687604 missense probably benign 0.04
R3781:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3782:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3851:Calcr UTSW 6 3693735 missense probably damaging 1.00
R3852:Calcr UTSW 6 3693735 missense probably damaging 1.00
R4190:Calcr UTSW 6 3717106 missense possibly damaging 0.82
R4387:Calcr UTSW 6 3707581 missense probably damaging 0.98
R4402:Calcr UTSW 6 3708484 critical splice donor site probably null
R4403:Calcr UTSW 6 3708484 critical splice donor site probably null
R4494:Calcr UTSW 6 3708484 critical splice donor site probably null
R4495:Calcr UTSW 6 3708484 critical splice donor site probably null
R4745:Calcr UTSW 6 3692576 missense probably damaging 0.99
R4857:Calcr UTSW 6 3708511 missense probably benign 0.29
R4883:Calcr UTSW 6 3714705 missense probably damaging 1.00
R5168:Calcr UTSW 6 3708610 missense probably benign 0.00
R5375:Calcr UTSW 6 3714651 missense probably benign 0.00
R5643:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5644:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5688:Calcr UTSW 6 3714730 synonymous probably null
R5799:Calcr UTSW 6 3707592 missense probably benign 0.13
R5920:Calcr UTSW 6 3722994 missense probably damaging 0.97
R6329:Calcr UTSW 6 3687621 missense probably damaging 1.00
R6357:Calcr UTSW 6 3714710 missense probably benign 0.00
R6365:Calcr UTSW 6 3711455 missense probably benign 0.00
R6393:Calcr UTSW 6 3708586 missense probably damaging 1.00
R6547:Calcr UTSW 6 3717177 missense probably damaging 1.00
R7034:Calcr UTSW 6 3692543 missense probably damaging 1.00
R7208:Calcr UTSW 6 3687612 missense probably benign 0.00
R7342:Calcr UTSW 6 3691536 missense probably benign 0.03
R7430:Calcr UTSW 6 3708586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACATGGGGTTGGTTTCCTTAC -3'
(R):5'- AAATGGCCATTTCTATTCCAGC -3'

Sequencing Primer
(F):5'- TCCTTACCTGGAAATGAATCAGAGAG -3'
(R):5'- CAGAGCCAAAAATTAGATGTGGTTC -3'
Posted On2018-02-28