Incidental Mutation 'R6255:Slc26a9'
ID506031
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R6255 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131763909 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 630 (D630G)
Ref Sequence ENSEMBL: ENSMUSP00000036916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000186122]
Predicted Effect probably benign
Transcript: ENSMUST00000049027
AA Change: D630G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: D630G

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186122
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0588:Slc26a9 UTSW 1 131754011 splice site probably benign
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R0926:Slc26a9 UTSW 1 131753216 missense probably benign 0.40
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4064:Slc26a9 UTSW 1 131763187 missense probably benign 0.01
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6418:Slc26a9 UTSW 1 131758490 missense probably benign 0.06
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAGCTGAGACGTTGCTCTCC -3'
(R):5'- CAGGAGTTGTCCACACAAGC -3'

Sequencing Primer
(F):5'- GAGACGTTGCTCTCCTGCCTC -3'
(R):5'- GAGTTGTCCACACAAGCTCCTC -3'
Posted On2018-02-28